Báo cáo y học: "HTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007" doc

... properly cited.ResearchHTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007Carla van Tienen*1, Maarten F Schim van der Loeff2, Ingrid ... B, da Silva Z, Vastrup P, Larsen O, Andersson S, Ravn H, Aaby P: Mortality associated with HIV- 1, HIV- 2, and HTLV-I single and dual infections in a middle-aged and older population in Guinea-Bissau. ... Larsen O, da Silva Z, Sandstrom A, Andersen PK, Andersson S, Poulsen AG, Melbye M, Dias F, Naucler A, Aaby P: Declining HIV- 2 prevalence and incidence among men in a community study from Guinea-Bissau....

Báo cáo y học: " Differences in the mannose oligomer specificities of the closely related lectins from Galanthus nivalis and Zea mays strongly determine their eventual anti-HIV activity" pdf

... glycanarray analysis that GNA strongly interacts with high-man-nose-type N-glycans and preferentially recognizes terminalmannose residues (Mana1,6Man > Mana1,3Man >Mana1,2Man), whereas ... antennae is favourable for GNAmaizebinding,although a glycan array revealed that GNAmaizeshowedthe highest binding affinities to biantennary (or mono-antennary) GlcNAc b1-2Man-containing ... determined by glycan array analysis and indicatedthat GNAmaizerecognizes complex-type N-glycans whereas GNA has specificity towards high- mannose-type glycans.Both lectins are tetrameric proteins...

Báo cáo y học: "Fluids in septic shock: too much of a good thing" doc

... ameliorated progression of microvascular and paren-chymal injury during the development of peritonitis in sheep. Su and colleagues [12] noted that starch, albumin, gelatin and Ringers lactate ... data provided by Brandt and colleagues [1] may need to be conﬁ rmed.  e observations that hemodynamic and mortality endpoints may not go in the same direction also deserve further explanation.Clinical ... C, Beale R, Calandra T, Dhainaut JF, Gerlach H, Harvey M, Marini JJ, Marshall J, Ranieri M, Ramsay G, Sevransky J, Thompson BT, Townsend S, Vender JS, Zimmerman JL, Vincent JL; International...

Báo cáo y học: "Patterns in deer-related traffic injuries over a decade: the Mayo clinic experience" pdf

... According to theNational Highway Traffic Safety Administration FatalityAnalysis Reporting System, an average of 111 fatalcrashes involved animals between 1992 and 1995increasing to 154 between ... vehicle and animal size [5-7]. Abu-Zidan et alfound Kangaroo-vehicle trauma in Australia resulted in a relatively mild pattern of injury with mostly head/face and ext remity trauma. One patient ... 31st,2006werereviewedfromourprospectively collected trauma database. Crashes due toother animals were eliminated. Demographic, clinical, and crash specific parameters were abstracted. Injuryseverity was analyzed b y the Abbreviated...

Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"

... onachieving a conversation, on being wary that formation affectsinteraction and that the substantial amount of information in the EPR might distract rather than add to the interaction, and on encouraging ... behav-iour to promote more effective interaction. This adaptation canbe seen by an increase in doctor–nurse interaction during theward round and a decrease in wandering attention seen 1 yearafter ... A qualitative study of morning ward rounds of anintensive care unit that triangulates data from video-basedinteraction analysis, observation, and interviews.Results Our analysis demonstrates...

Báo cáo Y học: The porcine trophoblastic interferon-c, secreted by a polarized epithelium, has speciﬁc structural and biochemical properties potx

... (d) was meas-ured by ELISA, and antiviral activity (h) was determined by antiviralassay on MDBK cells. Molecular weight standards and void volume(V0) are indicated by arrows, and the black ... measured mass is compatible with a nonglycosylated polypeptide starting with an N-terminalpyroglutamate and ending at C-terminal L126. Indeed such a peptide has a theoretical sequence mass (average) ... (Kirkegaard &Perry Laboratories Inc., or Sigma-Aldrich, USA). As a standard, porcine rIFN-c (CIBA-Geigy) was used at a concentration of 10 lgÆmL)1.Antiviral activity. Antiviral activity was...

Báo cáo y học: "The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions" potx

... isespecially true during the teenage and early adult years,relates mainly to cyclothymia and probably representsattempts at self-medication for the mood liability. Duringthe withdrawal period many ... malignancies(especially in the pancreas) and disseminated carcinoma-tosis. Also, there are a number of abnormal endocrineconditions including hypothyroidism and hyperthyroid-ism, hyperparathyroidism, hypopituitarism, ... brain magnetic resonance imaging (MRI)scans, and in late onset cases indices assessing malig-nancy.SuicideToday we know that suicide is a complex and multicausalbehaviour and demands a complex...

Báo cáo y học: " The histone chaperone protein Nucleosome Assembly Protein-1 (hNAP-1) binds HIV-1 Tat and promotes viral transcription" potx

... protein has 391 amino acids, contains three acidicdomains and has a long KIX-binding domain. Thisdomain and the C-terminal acidic domain are very con-served in other members of the NAP family ... usedhave already been described elsewhere [47,66-69].RNA interference (RNAi) with hNAP-1 was performedagainst the target sequence 5' AAGGAACACGAUGAACCUAUU 3'. An siRNA targeted against ... experimental design and data analysis. MG contrib-uted to the experimental design and coordination of thestudy, data analysis, as well as to writing the manuscript.All Authors have read and approved...

Báo cáo y học: " The Basic Immune Simulator: An agent-based model to study the interactions between innate and adaptive immunity" doc

... damageassociated with psoriasis and the secondary phase of typeIV hypersensitivity reactions such as atopic dermatitis.Interestingly, inflammatory dendritic epidermal cells and increases in ... levelof intricate, non-linear and potentially paradoxical behav-ior [7,16,19]. In order to aid in the qualitative characteri-zation and examination of this relationship, we introducethe BIS, an agent-based ... was used to qualitatively examine the innate and adaptive interactions of theimmune response to a viral infection. Calibration was accomplished via a parameter sweep of initialagent population...

Báo cáo y học: "Depressive symptoms from kindergarten to early school age: longitudinal associations with social skills deficits and peer victimization" potx

... 76(4):677-685.45. Alsaker FD, Olweus D: Stability and change in global self-esteem and self-related affect. In Understanding early adolescentself and identity: Applications and interventions SUNY series, ... Kenny DA: The moderator-mediator variable dis-tinction in social psychological research: Conceptual, strate-gic, and statistical considerations. Journal of Personality and SocialPsychology 1986, ... reran allanalyses reported in this paper, including interventionparticipation as a control variable. None of the reportedresults showed any change. Thus, in the final analyses thisvariable...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ