0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt

Báo cáo y học:

Báo cáo y học: "Identification of clinical and simple laboratory variables predicting responsible gastrointestinal lesions in patients with iron deficiency anemia"

... evaluate iron deficiency. Most of patients with iron deficiency in, whom gastrointestinal or systemic signs or symptoms are absent have an underlying ga-strointestinal lesion [24]. Idiopathic iron- deficiency ... â Ivyspring International Publisher. All rights reserved. Research Paper Identification of clinical and simple laboratory variables predicting re-sponsible gastrointestinal lesions in patients ... locus of the bleeding source. Bleeding lesions in the GI tract are identified in about 50% of patients with IDA [7-8]. Laboratory findings in IDA include elevated total iron- binding Int....
  • 9
  • 425
  • 1
Báo cáo y học:

Báo cáo y học: "Identification of Cellular Membrane Proteins Interacting with Hepatitis B Surface Antigen using Yeast Split-Ubiquitin System"

... soluble cellular < /b> proteins < /b> interacting < /b> with < /b> a bait of < /b> interest [5], it can not be applied in the isolation of < /b> those interacting < /b> with < /b> transmembrane bait proteins < /b> such as HBsAg. A yeast split-ubiquitin ... its interacting < /b> prey [5]. However, such a screening system is not suitable for the analysis of < /b> interaction between membrane < /b> bound proteins.< /b> The split-ubiquitin yeast two hybrid system has been ... Ivyspring International Publisher. All rights reserved Short research communication Identification of < /b> Cellular < /b> Membrane < /b> Proteins < /b> Interacting < /b> with < /b> Hepatitis < /b> B Surface Antigen using Yeast Split-Ubiquitin...
  • 4
  • 493
  • 0
Tài liệu Báo cáo Y học: Characterization of an omega-class glutathione S-transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities pptx

Tài liệu Báo cáo Y học: Characterization of an omega-class glutathione S-transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities pptx

... 269) Ó FEBS 2002 Characterization of an omega-class glutathione S -transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities Javier ... transferase enzymatic activities. Keywords: glutathione S -transferase; dehydroascorbate reductase; thiol transferase; Schistosoma. Glutathione S-transferases (GSTs, EC 2.5.1.18) constitute afamily of multifunctional ... related with thio-redoxins/glutaredoxins. Interestingly, SmGSTO was able tobind S-hexyl glutathione matrix and displayed significant glutathione- dependent dehydroascorbate reductase and thiol transferase...
  • 10
  • 638
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of subpopulations with characteristics of mesenchymal progenitor cells from human osteoarthritic cartilage using triple staining for cell surface markers" docx

... sorted cellsReanalysis of triple positive sorted cells. (a) Forward and side scatter characteristics of sorted osteoarthritic cartilage cells. (b-d) CD9-fluorescein isothiocyanate (FITC)/CD166-phycoerythrin ... split by trypsintreatment (0.05% trypsin, 0.02% EDTA; Biochrom) at 75%confluence.Flow cytometry analysis of cells Either isolated cells from OC were directly used for flowcytometric analysis ... specific staining. The distribution of OC cells in forward/side scatter exhib-ited no difference between isotype and antibody staining. Amaximum of 2% positive cells by staining with isotype anti-body...
  • 11
  • 346
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

... of the anti -SmD3 peptide (SMP) assayAssay performance characteristics of the anti -SmD3 peptide (SMP) assay. (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating ... (Rheumaklinik Aachen, Aachen, Germany), Prof.Dr MJ Fritzler (University of Calgary, Calgary, Canada) andby Labor Limbach (Heidelberg, Germany).To assess further the assay specificity, we analyzed ... 1Research articleIdentification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodiesMichael Mahler1,...
  • 11
  • 593
  • 0
Báo cáo y học:

Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt

... participated in analysis of data.CA performed the statistical analysis and the clinical associa-tions. AS participated in the analysis and interpretation of dataand in the revision of the manuscript. ... articleScreening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestationsPaola Margutti1, Maurizio ... experiments on endothelial cell line and apoptosis andparticipated in the design of the study and helped to draft the manuscript. FC participated in the design of the study and in analysis of data and...
  • 8
  • 375
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of kinectin as a novel Behçet''''s disease autoantigen" doc

... pathophysiology of endothelial cells, and antibody toendothelial cell antigen (AECA) has been reported. Reportson the prevalence of AECA have varied largely and alpha-eno-lase was reported as ... Reiter's syndrome, inflammatorybowel diseases etc. On the other hand, further analysis of theassociation of anti -kinectin antibody with different manifesta-tions or disease 'subtypes' ... 1). The 120 kDaantigen was also shown to migrate differently from alanyl tRNAsynthetase in another Western blot analysis (data not shown)and did not share any apparent crossreactive epitopes...
  • 7
  • 519
  • 0
Báo cáo y học:

Báo cáo y học: "TWEAK/Fn14 interaction regulates RANTES production, BMP-2-induced differentiation, and RANKL expression in mouse osteoblastic MC3T3-E1 cells" pot

... determined by using a cytokine protein array(TranSignal Mouse Cytokine Antibody Array 1.0; Panomics,Inc., Fremont, CA, USA) according to the manufacturer'sinstructions.Enzyme-linked ... articleTWEAK/Fn14 interaction regulates RANTES production, BMP-2-induced differentiation, and RANKL expression in mouse osteoblastic MC3T3-E1 cellsTakashi Ando1*, Jiro Ichikawa2*, Masanori Wako2, Kyosuke ... Collectively, TWEAK/Fn14 interaction regulates RANTES production, BMP-2-induced differentiation, and RANKL expression in MC3T3-E1 cells. TWEAK may thusbe a novel cytokine that regulates several aspects...
  • 10
  • 337
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of an altered peptide ligand based on the endogenously presented, rheumatoid arthritis-associated, human cartilage glycoprotein-39(263–275) epitope: an MHC anchor variant peptide for immune modulation" pot

... modification at the key MHC anchor position. The latter quality may add to improved safety of APL therapy.Ideally, the properties of an APL for immunotherapy of RAwould blend: affinity for MHC class ... substitutions mayfunction as partial TCR agonists on the one hand and preventunwanted immune reactivity on the other [32,33]. Thisapproach may thus provide an improved option for APLtherapy. The ... not shown).In conclusion, the analysis of both the hybridoma panel and the polyclonal T cell response to the 263–275 epitope has led to the identification of MHC binding and TCR contact residueswithin...
  • 11
  • 314
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element" ppt

... AccessIdentification of < /b> an < /b> effective < /b> siRNA < /b> target < /b> site < /b> and< /b> functional < /b> regulatory < /b> elements, < /b> within < /b> the< /b> hepatitis < /b> B virus posttranscriptional regulatory< /b> elementNattanan Panjaworayan1, Sunchai Payungporn2, Yong ... detected byreal-time PCR assay and < /b> used to prepare the < /b> standardcurve for quantitation of < /b> HBV cccDNA. The < /b> standardcurve of < /b> HBV cccDNA was then constructed by plotting the < /b> logarithm of < /b> the < /b> initial ... genome. Therefore target < /b> sites,although initially effective,< /b> might be able to b e m utated and < /b> the < /b> virus become resistant.In this study, we were interested to identify siRNA< /b> targets within < /b> the < /b> HBV...
  • 10
  • 372
  • 0
Báo cáo y học:

Báo cáo y học: " Effect of chemokine receptor CXCR4 on hypoxia-induced pulmonary hypertension and vascular remodeling in rats" pps

... fortherapeutic intervention in pulmonary hypertension. Pharmacol Ther2001, 92:1-20.3. Rabinovitch M: Pulmonary vascular remodeling in hypoxic pulmonary hypertension. In Hypoxic Pulmonary Vasoconstriction ... involvement of bone marrow cells in pulmonary hypertension and vascular remodeling. Although Young et al. reported thatinhibition of CXCR4 activity by AMD3100 decreased hypoxia-induced pulmonary hypertension ... [26]recently used a neonatal mouse model of pulmonary hypertension and found that the inhibition of CXCR4 activity significantly decreased hypoxia-induced pulmon-ary hypertension. Interestingly, Gambaryan...
  • 11
  • 261
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt

... placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the 3 main layers of the placenta indicatedFigure 6Structure and in situ hybridization for syncytin-Ory1 ... syncytin-Ory1 expression of day 12 rabbit placenta: (A) Schematic repre-sentation of a rabbit placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the 3 main layers ... RT-PCR assays for their in vivo tran-scriptional activity in a large panel of tissues including the placenta, cloning of the candidate genes, ex vivo assays fortheir fusogenicity and, ultimately,...
  • 11
  • 354
  • 0
Báo cáo y học:

Báo cáo y học: " Identification of two distinct structural regions in a human porcine endogenous retrovirus receptor, HuPAR2, contributing to function for viral entry" docx

... c-myc tag wasinserted into the pcDNA3.1(+)/Zeo HuPAR2 backbone bysite-directed mutagenesis with the following primer pair:5'-CCAGCTTTGGGCTGAATGGAACAAAAACTTATTTCT-GAAGAA GATCTGATGGCAGCACCCACG ... populations were assayed for PERV -A binding and infection by a FACS-based PERV -A SU IgG binding assay and a PERV pol qPCR-based infection assay. PERV pol copy numbers were normal-ized to wild-type ... relationships of HuPAR1 and HuPAR2are not only important to further a general understanding of gammaretroviral cell entry, but also, central to advanc-ing a science-based risk-assessment for a...
  • 15
  • 330
  • 0
Báo cáo y học:

Báo cáo y học: " Identification of unique reciprocal and non reciprocal cross packaging relationships between HIV-1, HIV-2 and SIV reveals an efficient SIV/HIV-2 lentiviral vector system with highly favourable features for in vivo testing and clinical usa

... cord injury and other inflammatory or destructiveconditions of the CNS[24,25].We investigated the cross packaging ability of the Gag-Polcomponents of HIV-1, HIV-2 and SIV and found a unique non -reciprocal ... 60% of glial cell expressing GFP with 20 ng of input vector and approximately 58% with 10 ng of vector. In summary, the gene transfer efficiency of the HIV-2 GFP vector to be cross packaged by SIV ... HIV-1 and HIV-2 homologous vector systems.Transduction of human embryonic neuronal stem cellswas also performed using the HIV-1 and HIV-2 homolo-gous vector system (not shown) and with the SIV...
  • 14
  • 437
  • 0
Báo cáo y học:

Báo cáo y học: " Identification of endogenous retroviral reading frames in the human genome" ppt

... embryo by means of the immunosuppressive domain [52].Two seemingly intact env genes not detected in the recentsurvey of intact human envelope genes [41] are equallyinteresting in terms of possible ... [2]. Finally, screening the human genome in silico does not guarantee detection of polymorphic HERV loci in which the empty pre-integra-tion site is still segregating in the human population.Indeed, ... However,none of them are completely intact. In fact, 41 of the above 59 long vORFs, are all betaretroviral and stem from the HERV-K group. Interestingly, 15 of the remaining 18non-betaretroviral...
  • 13
  • 303
  • 0

Xem thêm

Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ