Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... by unleashing NMDA and AMPA excitotoxic injury. Thus a mecha-nism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against ... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic ... by incubation with casein. Samples and standards were applied in duplicate and incubated overnight at 4°C. Following the Vgf capture phase, the plates were reacted with rabbit anti -Vgf antibody...
- 8
- 499
- 0
Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc
... 2011 The Authors Journal compilation ª 2011 FEBS Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus Benjamin Marie1,2, Isabelle Zanella-Cle´on3, Marion ... CaCO3precipitation. First, the effect of the nacre matrix started to occur above 1 lg of the ASM and the delay of the reaction was dose-dependent. At approximately 50 lg of nacre ASM, a complete ... most of them correspond to proteins of the pearl oyster or the abalone models. None of them were described from the cephalopod nacre. Although the Nautilus nacre has already been the focus of several...
- 14
- 383
- 0
báo cáo hóa học:" Research Article A Systematic Development Methodology for Mixed-Mode Behavioral Models of In-Vehicle " docx
... device mixed-mode behavioral model of a CAN bus transceiverand a generic mixed-mode behavioral model of a Flexrayphysical layer transceiver. The paper presents how the pro-posed methodology was applied ... behavior of mixed-mode- embedded systems are essential for achieving reliable simulation results. Thispaper presents a systematic development methodology for mixed-mode behavioral models of in-vehicle- embedded ... layer CAN transceiver and the physical layerFlexray transceiver.We have used VHDL-AMS hardware description lan-guage for the behavioral models implementation, due to thefact that it is an...
- 11
- 346
- 0
Báo cáo y học: "Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis" pps
... coronary angiography in the study by Weiss et al. showed a higher sensitivity and specificity for the detection of coronary stenosis by 3DMP than by 12-lead ECG [18]. One limitation of the ... systems. In the case of the heart, analysis is performed on the signals emitted by the heart, such as the surface resting electrical signal recorded by an ECG. In systems analysis, the ECG ... about the potential superiority or inferiority of 3DMP to other ECG- based methods can only be drawn indirectly from other studies. In conclusion, the mathematical analysis of the ECG done by...
- 15
- 456
- 0
Báo cáo y học: " Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis after coronary revascularization" doc
... nonobstructive coronary artery disease. Heart Dis. 2002; 4: 2-12. 22. Grube E, Bootsveld A, Yuecel S, et al. Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis. ... Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis after coronary revascularization Eberhard Grube1, Andreas Bootsveld2, Lutz Buellesfeld1, Seyrani ... coronary angiography in another study showed a higher sensitivity and specificity for 3DMP than for 12-lead ECG in the detection of coronary stenosis [21]. One limitation of the present study...
- 12
- 418
- 0
Báo cáo y học: "Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia" ppt
... Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia Shi Tan1, Ling Zhang1, Xiao-Ming Zhong1, Zai-Lin Yang2, Liu-Yang Zhao1, Yu-Jie ... value of their detection by immunocytochemistry. Blood. 2002; 99: 409-26. 17. Falini B, Mecucci C, Tiacci E, et al. Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype. ... and antibody production were subjected to subcloning. Antibodies secreted by the 2G3 clones were found to be IgG iso-type. The specificity of the mAbs against NPM-mA was assessed by indirect...
- 6
- 431
- 0
Báo cáo y học: " MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppt
... No 1Research article MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damageYu M Tan1,2, Mikkel ... despite there being no evidence of greater diseaseactivity in terms of clinical scores (skin or joint) or inflammatorymarkers. Interestingly, the MRI bone oedema score was also higher in the AM ... also higher in the AM group. Interestingly, bone oedema scores were highly correlated with MRI and XR ero-sion and joint space narrowing scores, suggesting that thisfeature occurs in those with...
- 9
- 521
- 0
Báo cáo y học: "Soluble RAGE: a hot new biomarker for the hot joint" pdf
... membrane. J Rheumatol 1999, 26:2523-2528.10. Yan SF, Ramasamy R, Naka Y, Schmidt AM: Glycation, inflam-mation and RAGE: a scaffold for the macrovascular complica-tions of diabetes and beyond. ... such as the following: Do plasma sRAGE levels vary from day to day in a subject? Do they vary over the lifespan of the individual?What were the levels of sRAGE in the RA subjects before the onset ... collagen-induced arthritisattenuated clinical scores of joint inflammation, in parallel withCommentarySoluble RAGE: a hot new biomarker for the hot joint?Bernhard Moser, Barry I Hudson and Ann...
- 3
- 368
- 0
Báo cáo y học: "Chondroitin and glucosamine sulfate in combination decrease the pro-resorptive properties of human osteoarthritis subchondral bone osteoblasts: a basic science study" pptx
... interpretation of data. HF and ML participated in acquisition of data. J-PP participated in analysis and interpretation of data and manuscript preparation.All authors read and approved the final manuscript.Acknowledgements The ... data, analysis and interpretation of data, manuscript preparation, and statisticalanalysis. JV and EM participated in study design. DL partici-pated in acquisition, analysis, and interpretation ... symptoms in OA patients having mod-erate to severe knee pain [7]. Glucosamine is an aminosaccharide that acts as a preferredsubstrate for the biosynthesis of glycosaminoglycan (GAGchains and, ...
- 10
- 599
- 1
Báo cáo y học: "Common interleukin-6 promoter variants associate with the more severe forms of distal interphalangeal osteoarthritis" pot
... studypolymorphic effects on the synthesis of IL-6 have shown thatits transcription and synthesis are affected by the allelic varia-tions within the gene, although the mechanism and level of the contribution ... in the light of the fact that both of these G alleles substantiallyincreased the risk of symptomatic OA in our material. Individu-ally, the G allele of the G-174C variation has repeatedly beenTable ... of the IL-6 gene and is associated with plasma levels of IL-6 [15]. The activity of the promoter isalso affected by the nearby polymorphic sites at -597 and -572, which seem to control the...
- 9
- 272
- 0
Báo cáo y học: "T-614, a novel immunomodulator, attenuates joint inflammation and articular damage in collagen-induced arthritis" docx
... AGGGACAA-3'IFN-γ 5'-GAAAGACAACCAGGCCATCAG-3' 5'-TCATGAATGCATCCTTTTTTGC-3'IL-4 5'-CCACGGAGAACGAG CTCATC-3' 5'-GAGAACCCCAGACTTGTTCTTCA-3'IL-17 5'-GGGAAGTTGGACCACCACAT-3' ... infiltration and participate in a number of inflammatory and destructive events, such as synovial hyperplasia, pannus for-mation, cartilage and bone erosion, and joint malformation [5-8]. RA was ... signal within nor-mal hypointense area at this site (arrowhead).Joints of naïve (non-CIA) rats exhibited intact joint architecture.The talus, phalanges, talocalcaneal joints, talonavicular articu-lations...
- 11
- 375
- 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... features include dextrocardia, L-transposition of the great arteries, abdominal situs inversus, bilateral (a) t TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... 51. Kitamura K, Miura H, Miyagawa-Tomita S, Yanazawa M, Katoh-Fukui Y, Suzuki R, Ohuchi H, Suehiro A, Motegi Y, Nakahara Y, Kondo S, Yokoyama M: Mouse Pitx2 deficiency leads to anomalies of...
- 36
- 446
- 0
Báo cáo y học: " Fluorodeoxyglucose-positron emission tomography/computed tomography in the staging and evaluation of treatment response in a patient with Castleman''''s disease: a case report" pps
... tomography/ computed tomography in the staging and evaluation of treatment response in a patient with Castleman's disease: a case reportEttore Pelosi*1, Andrea Skanjeti†2, Angelina ... in a patient with a mediastinal mass. Then, otherauthors reported new cases of the disease with differentlocalisations, including abdominal and superficial lymphnodes. The aetiology and pathogenesis ... drafting the manuscript. AC was involved in reviewing the literature and proofreading the manuscript. VA approved the finalmanuscript.ConsentWritten informed consent was obtained from the patient for...
- 4
- 360
- 0
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
... anti -Tax1 anti- The Tax1 (18 5-207) region negatively regulates the transforming activity of Tax1Figure 7 The Tax1 (18 5-207) region negatively regulates the transforming activity of Tax1. (A) The amino ... T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2Toshiyuki Shoji 1, 2, Masaya Higuchi 1 , Rie Kondo 1 , Masahiko Takahashi 1 , Masayasu Oie 1 , Yuetsu Tanaka3, Yutaka Aoyagi2 ... anti -Tax1 antibody.C) Tax1 L1 91- 19 5A Tax1 L20 0A Tax207 Tax1 Tax 211 Tax1 18 5 18 5 211 ωޓ ωω ωL1 91- 19 5A L20 0A ዪዲዬድዧዮዥዡዡየየድዧዥዯየደደዣዝየዥዥየዬዡዠCryptic NESዝޓ ዝዝޓޓޓޓዝ A) B)020406080 10 0 Tax1 Tax1L1 91- 19 5A Tax1 L20 0A Tax207Transformation...
- 11
- 548
- 0
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot
... Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan, 7Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125, Japan, 8Laboratory of Disease ... Hirofumi Akari8, Yoshio Koyanagi9, Jun Fujita3 and Takashi Uchiyama1Address: 1Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho, Sakyo-ku, ... previouslyreported that Gankyrin itself doesn't have an enzymaticactivity and that it rather enhances the E3 ligase activity of MDM2 on p53 ubiquitination and degradation as a co-factor [19], we...
- 12
- 692
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP