Báo cáo khoa học: " A Lung and ''''''''end organ'''''''' injury due to mechanical ventilation in animals: comparison between the prone and supine positions" pdf

Báo cáo khoa học: " A Lung and ''''end organ'''' injury due to mechanical ventilation in animals: comparison between the prone and supine positions" pdf

Báo cáo khoa học: " A Lung and ''''end organ'''' injury due to mechanical ventilation in animals: comparison between the prone and supine positions" pdf

... prominent in the prone position. Transaminases (aspartate aminotransferase and alanine aminotransferase) increased during mechanical ventilation in the supine position, while they were both unchanged ... overdistention and shear stress (barotrauma or volutrauma) as well as mechanical damage due to the produc- tion, release and/ or activation of cytotoxic and inf...
Ngày tải lên : 12/08/2014, 23:21
  • 9
  • 459
  • 0
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx

Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx

... 77 4agt_Arath 4 -a- glucanotransferase n.d. Arabidopsis thaliana AAL91204 955 77 4agt_Orysa 4 -a- glucanotransferase n.d. Oryza sativa BAC22431 922 77 (Dark red of Fig. 2) agwdArath a- glucan water dikinase ... FEBS 58 Nakamura Y, Kaneko T, Sato S, Mimuro M, Miyashita H, Tsuchiya T, Sasamoto S, Watanabe A, Kawashima K, Kishida Y, Kiyokawa C, Kohara M, Matsumoto M, Matsuno A, Nakazaki N, Sh...
Ngày tải lên : 07/03/2014, 21:20
  • 17
  • 476
  • 0
Báo cáo khoa học: "A rare case of isolated wound implantation of colorectal adenocarcinoma complicating an incisional hernia: case report and review of the literature" pdf

Báo cáo khoa học: "A rare case of isolated wound implantation of colorectal adenocarcinoma complicating an incisional hernia: case report and review of the literature" pdf

... hernia and presented in the anterior abdom- inal wall. Tumour markers were negative and there was no intra-abdominal pathology. Wound implantation in an incisional scar after open surgery is rare, ... tis- sue the anterior abdominal wall was visualised. The two incisional hernia sacs were each identified and freed from their attachments to the anterior abdominal wall allow...
Ngày tải lên : 09/08/2014, 07:21
  • 6
  • 227
  • 0
Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot

Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot

... On the next day, the lysate was centrifuged as before to produce a supernatant SII and a pellet PII. The A 260 of the SI and SII fractions was measured, and the amount of DNA present in the samples ... N-terminal and C-ter- minal domains of canonical H1 histones. As stated by Hansen et al. [51], there are many structural features, such as lower binding energy, gr...
Ngày tải lên : 08/03/2014, 08:20
  • 14
  • 484
  • 0
Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx

Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx

... the amino acids within the binding domain of RAMY protein and analyzed the time course for the induction of RAMY a nd a- amylase mRNA by GA. Correspondence to Q. Yao, Shanghai Key Laboratory of Agricultural Genetic ... prior to that of the Amy2 mRNA level in the GA-treated aleurone tissues. These data suggest that RAMY may act as a trans-acting protein and is probab...
Ngày tải lên : 16/03/2014, 18:20
  • 7
  • 359
  • 0
Báo cáo khoa học: A monoclonal antibody, PGM34, against 6-sulfated blood-group H type 2 antigen, on the carbohydrate moiety of mucin doc

Báo cáo khoa học: A monoclonal antibody, PGM34, against 6-sulfated blood-group H type 2 antigen, on the carbohydrate moiety of mucin doc

... tested were assigned to the appropriate acidic oligosaccha- ride-alditols, bearing either a sulfate or a sialic acid residue, as well as having N-acetylgalactosaminitol (GalNAc-ol) at the reducing terminus ... the normal mucosa and carcinoma of the large intestine. Galactose oxidase-Schiff reaction and lectin stainings. Acta Pathol Jpn 35, 1409–1425. 12 Ishihara K, Kurihara...
Ngày tải lên : 23/03/2014, 09:21
  • 16
  • 296
  • 0
Báo cáo khoa học: A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus ppt

Báo cáo khoa học: A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus ppt

... GGCCTCCCTAAGCTTCTGGACCTTTTCGCGTGTTGCTTCCGACATAGGAACGAG zeocin–pyrG forward GAATTCTCAGTCCTGCTCCTCGGCC zeocin–pyrG reverse GATATCGAATTCGCCTCAAACAATG Nested forward GAGACCTAGGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATAT Nested reverse GAGACCGCGGAAGCTTCTGGACCTTTTCGCGTGTTGCTTCCGACATAGGA NRP ... fumigatus actin forward CGAGACCTTCAACGCTCCCGCCTTCTACGT Aspergillus fumigatus actin reverse GATGACCTGACCATCGG...
Ngày tải lên : 30/03/2014, 10:20
  • 16
  • 361
  • 0
Báo cáo khoa học: "A Non-negative Matrix Tri-factorization Approach to Sentiment Classification with Lexical Prior Knowledge" potx

Báo cáo khoa học: "A Non-negative Matrix Tri-factorization Approach to Sentiment Classification with Lexical Prior Knowledge" potx

... classifi- cation by labeling words. In AAAI. V. Ng, S. Dasgupta, and S. M. Niaz Arifin. 2006. Ex- amining the role of linguistic knowledge sources in the automatic identification and classification ... A. Jadhav, A. Joshi, S. Chakrabarti, and P. Bhattacharyya. 2003. Question answering via bayesian inference on lexical relations. In ACL, pages 1–10. T. Sandler, J. Blitzer, P. Tal...
Ngày tải lên : 30/03/2014, 23:20
  • 9
  • 459
  • 0
Báo cáo khoa học nông nghiệp " Replacing fertiliser N with rhizobial inoculants for legumes in Vietnam for greater farm profitability and environmental benefits " MS4 docx

Báo cáo khoa học nông nghiệp " Replacing fertiliser N with rhizobial inoculants for legumes in Vietnam for greater farm profitability and environmental benefits " MS4 docx

... Extension and training of farmers and advisors Extension and training of farmers and advisors is a major focus of the project as a means of facilitating adoption of legume inoculation in Vietnam. The ... national legume inoculant program. At the institutional level, the gaps are capacity for medium-scale inoculant production and associated quality assurance (QA) a...
Ngày tải lên : 21/06/2014, 04:20
  • 34
  • 494
  • 0
Báo cáo khoa học nông nghiệp " Replacing fertiliser N with rhizobial inoculants for legumes in Vietnam for greater farm profitability and environmental benefits " MS6 potx

Báo cáo khoa học nông nghiệp " Replacing fertiliser N with rhizobial inoculants for legumes in Vietnam for greater farm profitability and environmental benefits " MS6 potx

... conducted in 10 main legume-growing areas in Vietnam, from the highlands in the North, to the Central Coast area to the highlands in the South and Mekong Delta. The provinces involved were Son La, ... U.S .A and Australia. However, physical and chemical analyses of a peat are only a partial assessement of its suitability as a carrier. Only a test rel...
Ngày tải lên : 21/06/2014, 04:20
  • 44
  • 404
  • 0

Xem thêm

Từ khóa: