Báo cáo khoa học: " A Effect of oral decontamination with chlorhexidine on the incidence of nosocomial pneumonia: a meta-analysis" pot

... nosocomial pneumoniaImpact of oral decontamination with chlorhexidine on nosocomial pneumonia. Random effects model. CI, confidence interval; OR, odds ratio.Figure 2Impact of oral decontamination with ... conducted a meta-analysis of available clinical trials to eval-uate the efficacy of oral chlorhexidine application on the inci-dence of NP in patients who required mechanical ventilation.Materials ... http://ccforum.com/content/10/1/R35Page 1 of 6(page number not for citation purposes)Vol 10 No 1Research Effect of oral decontamination with chlorhexidine on the incidence of nosocomial pneumonia: a meta-analysisLilibeth...

Báo cáo khoa học: "Oral decontamination with chlorhexidine reduces the incidence of nosocomial pneumonia" doc

... in the majority, based on clinical criteria and endotracheal aspiratesrather than on quantitative cultures of the lower respiratorytract. Given the limitations of these diagnostic criteria, the proof ... use a randomeffects model to account for the between-study variations with regard to an overall mean of the effects of all the studies[8]. There were variations among the studies in terms of the CHX ... Page 3 of 3(page number not for citation purposes)References1. Pineda LA, Saliba RG, El Solh AA: Effect of oral decontamina-tion with chlorhexidine on the incidence of nosocomial pneu-monia:...

Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc

... Biotech, Auburn, CA, USA). All researchmice at CINVESTAV and Trudeau Institute were eutha-nized by CO2narcosis in accordance with the recommenda-tions of the Panel on Euthanasia of the AVMA and ... 2:5¢-(CCCTCTAGACCAGATCCTTCACGTATTAAGTCTACACG)-3¢; CD38-G68E, primer 3: 5¢-(GATGAGGCAGCGCTCGagGAAGATGTC)-3¢; CD38-G68E, primer4: 5¢-(GGGGAATTCATGGCTAACTATGAATTTAGCCAG)-3¢. The E150L PCR product was ... homodimers.As CD38 dimers appear to be stabilized via noncovalentinteractions between monomers, a reasonable assumption isthat mutations within the potential interface domains mightalter the formation...

Báo cáo khoa học: Adenine and adenosine salvage pathways in erythrocytes and the role of S-adenosylhomocysteine hydrolase A theoretical study using elementary ﬂux modes Stefan Schuster and Dimitar Kenanov ppt

... esaKGPmiCLGPTAPDAP6GDHesaLGPOGP6OC2URP5PDANHSG2GGSSHPDANSGxoHGRGSSP5RP5XP7SAGP3P6FP4EKTIT A IP5REP5uXKTIIAGP3GP2MGPPDAPT A PEPNEKPPDAPTARYPtxeRYPsn a rtRYPCALCALetxC A LtrasnHDLHDANDANNEDAIENPPRPTRPDAPMAPMIODA ON IPMADACUNADACUNXPYHPPRPTRPGHP1RXPYHetxP5RMRPysPPRPnPT A PMAPTAKAPDAPD A PMApAKesaPNPPTAPDA a N+aN+kaelaNK+K+k a elKKaNaPT A seenarbmemMAStxeMAS2HHASodA-SHycTMYCH1HHASobiRoteK'3escAcYCHFPKHDP6LGXHartnsccAteM++Fig. ... second andadditionally, third parts 12 pathways starting fromS-adenosylmethionine involving the standard function-ality of SAHH (here denoted as SAHH1) and another10 pathways starting from adenosine ... Thisgives additional support for considering elementarymode analysis as an appropriate tool for metabolicpathways analysis [21].It follows from our calculations that there is nosalvage pathway starting...

Báo cáo khoa học: "Malignant gastrointestinal stromal tumor presenting with hemoperitoneum in puerperium: report of a case with review of the literature" ppt

... was in accordance with her last menstrual periodand the fetal growth was within the normal limits aswell, according to the patient’s information. She had a normal delivery at term at a Private ... Thivi Vasilakaki4, Evangelia Skafida4AbstractBackground: Gastrointestinal stromal tumors (GISTs) are mesenchymal tumors that develop in the wall of the gastrointestinal tract and their diagnosis ... consulting and pathology examination and has edited the manuscript. ES has diagnosed and edited the manuscript. All authors readand approved the final manuscript.Competing interests The authors declare...

báo cáo khoa học: " Social networks, work and network-based resources for the management of long-term conditions: a framework and study protocol for developing self-care support" potx

... implicate a combination of the p erson with the condition, mem-bers of their personal communities, community groups,health professionals, and nonhealth professionals, as wellas what can be ... members of personal communitiesmay be i mplicated alongside the reconfiguration of the roles that health professionals play in LTCM.AbbreviationsLTC: Long Term Condition ManagementAcknowledgements ... responsibility (whoNon-health professionals with health related and health relevant functionsCase managementDisease managementSelf managementHealth professionalsPeople with LTCs (as patients,...

Báo cáo khoa học: "Correction: Bispectral index versus COMFORT score to determine the level of sedation in paediatric intensive care unit patients: a prospective study" pps

...

Tài liệu Báo cáo khoa học: "An Information-Theory-Based Feature Type Analysis for the Modelling of Statistical Parsing" docx

... information redundancy can beused as a measure of the redundancy between the predictive information of a feature type andthat of a feature type combination. Predictive Information Summation ... is larger than that of the headword of the parent node which has the largest predictive information quantity among all of the history feature type candidates. That is tosay, objective feature ... research aims at a quantitative analysis of the differences among the predictive informationquantities provided by the lexical feature types,part -of- speech feature types and constituentlabel...

Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

... Because the pH of the protein solu-tion may change on the addition of the osmolytes, the pH of each solution was also measured after each measurement.It was observed that the change in pH was ... counteraction by methylamines of urea effects on aldose reductase. Proc Natl Acad SciUSA 96, 6517–6522.21 Poddar NK, Ansari ZA, Singh RK, Moosavi-MovahediAA & Ahmad F (2008) Effect of monomeric ... Dar TA, Haque I, Anjum F, Moosavi-Movahedi AA & Ahmad F (2007) Testing the paradigmthat the denaturing effect of urea on protein stability isoffset by methylamines at the physiological...

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

... clinical trials conducted so far have inexorably failed.Critical re-evaluation of experimental data shows that all the components of the neurovascular unit, such as neurons, glia, endothelia and ... his-tological basis. Also, careful and rigorous selection of patients with salvageable tissue [evidenced using mag-netic resonance imaging as the presence of an area of hypoperfusion larger than that of ... generation and release of ROS from NADPH oxidase and mitochondria, sus-tained increase of the cytosolic Ca2+concentrationand ﬁnally nuclear translocation of mitogen-activatedprotein kinase...

Xem thêm