Báo cáo khoa học: " Renal blood flow in sepsi" pptx
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... treat-ment and potential links to data quality. This understand- ing provides insight into potential errors (bias and random error) related to data based on clinical examina- Acta Veterinaria ... data and decision mak-ing in relation to treatment of metritis and their motiva-tion to produce data. This information was condensedinto a 'model of understanding' that demonstrates ... ways and for many reasons. In the followingwe will discuss the consequences of variation and bias in relation to monitoring of animal disease incidence onherd and national level, causal analysis...
- 10
- 587
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... subcellular fractionationTo analyze the cellular localization of zebrafishRPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the specificity of the antibody was ... system (AlphaIn-notech, San Leandro, CA, USA). The bands (inten-sity · area) were semi-quantified by densitometry usingALPHAVIEW Q software (AlphaInnotech), and averaged fromat least three independent...
- 14
- 753
- 0
Báo cáo khoa học: Expression of cholinesterases in human kidney and its variation in renal cell carcinoma types pdf
... carcinomasFEBS Journal 277 (2010) 45194529 ê 2010 The Authors Journal compilation ê 2010 FEBS 4523 Expression of cholinesterases in human kidney and its variation in renal cell carcinoma types Encarnacio´n ... renal cholinesterases are still lacking. To fill the gap and todetermine whether cholinesterases are abnormally expressed in renal tumours, paired pieces of normal kidney and renal cell carcinomas ... extent of binding with thelectins concanavalin A, Lens culinaris agglutinin(LCA), and Ricinus communis agglutinin (RCA)(Fig. 3), ruled out the blood origin and supported the renal cells themselves...
- 11
- 474
- 0
Báo cáo khoa học: "Alternating Quantifier Scope in CCG*" pptx
... can program in every program- ming language which has a scope- inverting read- ing meaning that every programming language is known by some linguist, (19a) has no reading mean- ing that there ... their involvement in CCG explains not only scope alternation (including occasions on which scope al- ternation is not available), but also certain cases of anomalous scopal binding which ... imply that only those so- called quantifiers in English which can engender dependency-inducing scope inversion have interpre- tations corresponding to genuine quantifiers. The others are not...
- 8
- 263
- 0
Báo cáo khoa học: "Resolving Zero Anaphora in Japanese" pptx
... the interpretation of zero anaphora in Japanese discourse. 1 Introduction Over the past years, schemes like Focusing and Cen- tering have dominated computational approaches to resolving anaphora ... water. Then put in salt. Add meat after 5 rain. We see that 14 constitutes a single discourse segment. According to the minimal semantics thesis, all of the zeros in the segment are interpreted ... are the facts:(a) zero anaphora occurring within the quotation (internal anaphora) are coreferential either with Taro or with Masako; (b) those occurring outside (external anaphora) , however,...
- 7
- 317
- 0
báo cáo hóa học:" Luteal blood flow in patients undergoing GnRH agonist long protocol" pot
... gonadotropin-releasing hormone agonist (GnRHa long protocol) causes luteal phase defect because it drastically suppresses serum LH levels. Examining luteal blood flow in the patient undergoing GnRHa long ... the decrease in blood flow is caused in p atients with luteal phase defect, andhow luteal blood flow is regulated in the ovary duringthe menstrual cycle. Luteal blood flow was increased by* ... relationshipbetween luteal blood flow and luteal function [4]. Inter-estingly, luteal blood flow was significantly correlatedwith serum progesterone concentration during the mid- luteal phase, and luteal blood...
- 6
- 283
- 0
Báo cáo khoa học:Global defensive alliances in graphs pptx
... dominating set if N[S]=V ,andisatotal dominating set oran open dominating set if N(S)=V . The minimum cardinality of a dominating set (re-spectively, total dominating set) of G is the domination ... 1 Introduction Alliances in graphs were first defined and studied by Hedetniemi, Hedetniemi, and Kris-tiansen in [4]. In this paper we initiate the study of global defensive alliances ... [2]. In [4] Hedetniemi, Hedetniemi, and Kristiansen introduced several types of alliances, including defensive alliances that we consider here. A non-empty set of vertices S ⊆ V iscalled a defensive...
- 13
- 220
- 0
Báo cáo khoa học: " Peripheral blood complete remission after splenic irradiation in Mantle-Cell Lymphoma with 11q22-23 deletion and ATM inactivation" pot
... OncologyOpen AccessShort report Peripheral blood complete remission after splenic irradiation in Mantle-Cell Lymphoma with 11q22-23 deletion and ATM inactivationAndrea Riccardo Filippi*1, Pierfrancesco ... E: ATM gene inactivation in mantle cell lymphoma mainly occurs bytruncating mutations and missense mutations involving thephosphatidylinositol-3 kinase domain and is associated with increasing ... involvement as main clinical features. The patient underwent moderate dose splenic radiation therapy and achieved spleen downsizing and peripheral blood complete remission. Splenic irradiation has...
- 3
- 205
- 0
Báo cáo khoa học: " Renal histomorphology in dogs with pyometra and control dogs, and long term clinical outcome with respect to signs of kidney disease" pptx
... Veterinaria ScandinavicaOpen AccessResearch Renal histomorphology in dogs with pyometra and control dogs, and long term clinical outcome with respect to signs of kidney diseaseReidun Heiene*1, Veronica ... the 19 dogs with pyometra in the originalstudy. Renal biopsies of dogs with pyometra were obtained dur-ing ovariohysterectomy using theBardđ Biopty-Cutđ device(C.R. Bard Inc., Covington, ... evidence ofclinical signs of renal failure in order to document causes of death/euthanasia.Results: Interstitial inflammation and tubular atrophy were more pronounced in dogs with pyometra than in...
- 9
- 409
- 0
Báo cáo khoa học: "Increased blood lacate levels: an important warning signal in surgical practice" pot
... pressure did notCommentaryIncreased blood lacate levels: an important warning signal in surgical practiceJan Bakker1and Alex Pinto de Lima21Head, Department of Intensive Care, Erasmus Medical ... levels in whole blood decreasingturnaround times greatly. Current handheld devices andmobile blood gas analyzers have decreased turnaround timeto less than 2 min using a minimal amount of blood ... thesecircumstances indicate, and what would be the mostappropriate therapy in these patients?The circulation is a demand driven system in which increases in oxygen demand are met by increases in oxygen...
- 3
- 195
- 0
Báo cáo y học: "Increased blood flow prevents intramucosal acidosis in sheep endotoxemia: a controlled study" pptx
... CRAI Sur, CUCAIBA, Argentina6Staff Physician, Intensive Care Unit, Hospital San Martin de la Plata, Argentina7Staff Physician, Clinical Chemistry Laboratory, Hospital San Martin de La Plata, ... Argentina8Medical Director, Intensive Care Unit, Hospital San Martin de la Plata, ArgentinaCorresponding author: Arnaldo Dubin, arnaldodubin@speedy.com.arAbstractIntroduction Increased intramucosal arterial ... experimental endotoxemia. Because intramucosal acidosis can appear with normal or increased blood flow, it has beenascribed to a defect in cellular metabolism, namely cytopathichypoxia [6]. It has also...
- 8
- 225
- 0
Báo cáo khoa học: " Renal blood flow in sepsi" pptx
... output; inc, increased; RBF, renal blood flow; unc, unchanged.Figure 2Effect of variables on renal blood flow: nonsignificant findingsEffect of variables on renal blood flow: nonsignificant findings. ... 1238PAH-RPF, renal plasma flow calculated using para-aminohippurate clearance with no renal vein sampling; true RPF, true renal plasma flow (flow calculated with renal vein sampling for PAH). ... articles using the following search terms:&apos ;renal blood flow& apos;, 'kidney blood flow& apos;, &apos ;renal blood supply', 'kid-ney blood supply', 'organ blood flow& apos;,...
- 12
- 511
- 0
Báo cáo khoa học: " Renal blood flow in sepsis: a complex issue" pptx
... sepsis and the regional variability in renal blood flow present a difficult challenge for the clinician orinvestigator in understanding the role and clinical importance ofreduced blood flow in ... 327ARF = acute renal failure; CLP = cecal ligation and puncture; LPS = lipopolysaccharide; RBF = renal blood flow. Available online http://ccforum.com/content/9/4/327AbstractThe clinical complexity ... develop acute renal failure.Langenberg and colleagues [1] have completed anexhaustive literature review documenting the effect of sepsison total renal blood flow (RBF) in humans and in animalmodels...
- 2
- 183
- 0
Báo cáo khoa học: "Does cardiac surgery in newborn infants compromise blood cell reactivity to endotoxin" docx
... messagesã Cardiac surgery in newborn infants decreases the reac-tivity of blood cells to LPS.ã Cardiac surgery in newborn infants might lead to an anti-inflammatory shift of the cytokine balance.ã ... suggested that, in the setting of cardiac surgery, parenchymatous cells such as cardiomyocytes contribute to the systemic inflammatory reaction by producing cytokines,circulating blood cells, in particular ... leading to hyporesponsiveness to LPS in newborn infants reported here are not yet clear. However,the anti-inflammatory cytokines IL-10 and tissue growth factor-β are thought to be important in...
- 7
- 269
- 0
Báo cáo y học: " Increased blood flow by insulin infusion targeting normoglycemia in patients with severe sepsis: friend or foe" ppt
... illness, but the clinical consequences remain unclear.â 2010 BioMed Central Ltd Increased blood ow by insulin infusion targeting normoglycemia in patients with severe sepsis: friend or foe?Greet ... nonblinded nature of the study, however, may have played a confounding role. Nevertheless, if the increase in forearm fl ow is indeed evoked by the more intensive insulin therapy, it corroborates ... levels of blood glucose with insulin in patients with severe sepsis [1]. As compared with a blood glucose target of 7 to 11 mmol/l, targeting a blood glucose level of 4.4 to 6.1 mmol/l increased...
- 2
- 226
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ