0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Characteristics of equine summer eczema with emphasis on differences between Finnhorses and Icelandic horses in a 11-year study" pdf

Báo cáo khoa học:

Báo cáo khoa học: "Characteristics of equine summer eczema with emphasis on differences between Finnhorses and Icelandic horses in a 11-year study" pdf

... ScandinavicaOpen AccessResearchCharacteristics of equine summer eczema with emphasis on differences between Finnhorses and Icelandic horses in a 11-year studyRaija E HallamaaAddress: Veterinary Clinic, ... Pisteenkaari 4, 03100 Nummela, FinlandEmail: Raija E Hallamaa - raija.hallamaa@elisanet.fiAbstract Summer eczema, allergic dermatitis of the horse, was studied on 275 affected horses in Finland in 1997–2007. ... severalsimultaneous aggravating factors. In Finland, equine summer eczema affects typically nativeScandinavian horse breeds, the Finnhorse and Icelandic horse, and the severity of clinical signs...
  • 6
  • 363
  • 0
 Báo cáo khoa học:

Báo cáo khoa học: "Effect of intern’s consecutive work hours on safety, medical education and professionalism"

... the same number of interns, in the traditional armwould have meant that each intern admitted and cared formore patients. In other words, each intern would have had a heavier workload and, therefore, ... notcompromise care.Competing interestsCAC was paid an honorarium to deliver a plenary address foran annual educational conference of the ACGME.528ACGME = Accreditation Council for Graduate Medical Education.Critical ... performance of upper-levelresidents and other medical staff across a variety of disciplines. We likewise agree that optimizing patient hand-offs, medical education, and trainees’ sense of professionalism...
  • 3
  • 514
  • 0
Báo cáo khoa học: Suppression of microtubule dynamics by benomyl decreases tension across kinetochore pairs and induces apoptosis in cancer cells potx

Báo cáo khoa học: Suppression of microtubule dynamics by benomyl decreases tension across kinetochore pairs and induces apoptosis in cancer cells potx

... 30777–30784.50 Mukae N, Enari M, Sakahira H, Fukuda Y, Inazawa J,Toh H & Nagata S (1998) Molecular cloning and char-acterization of human caspase-activated DNase. ProcNatl Acad Sci USA 95, 9123–9128.51 ... polyclonal antiPARPIgG were purchased from Santa Cruz Biotechnology (SantaCruz, CA, USA). Antimouse IgG-alexa 568 conjugate and Antiproliferative mechanism of action of benomyl K. Rathinasamy and ... benomyldecreases tension across kinetochore pairs and inducesapoptosis in cancer cellsK. Rathinasamy and D. PandaSchool of Biosciences and Bioengineering, Indian Institute of Technology Bombay, Mumbai,...
  • 15
  • 333
  • 0
báo cáo khoa học:

báo cáo khoa học: "Engineering of the E. coli Outer Membrane Protein FhuA to overcome the Hydrophobic Mismatch in Thick Polymeric Membranes" pdf

... thephenomena (a) and (b) (see next paragraph).TheTMBconversionbythefreeHRPresultsinfastkinetics (black diamonds) indicating that the compara-tively slow conversion rate in case of polymersomes with inserted ... funding.Authors’ contributionsNM and TD carried out design and performed study, data analysis and drafting of the manuscript. MF designed research. US contributed to writethe paper. All authors read and approved ... channelfunctionality.Based on the observation that the original FhuAΔ1-159 is able to independently refold after thermaldenaturation (data not published), showing that foldinginformation...
  • 9
  • 438
  • 0
báo cáo khoa học:

báo cáo khoa học: " Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida" pot

... EF1alpha TUB EF1alpha TUB EF1alpha TUB EF1alpha8 GAPDH TUB RAN1 RAN1 ACT SAND ACT GAPDH ACT SAND ACT SAND9 RAN1 CYP GAPDH TUB GAPDH GAPDH GAPDH SAND GAPDH GAPDH GAPDH GAPDHGene expression data ... Glyceraldehyde-3-phosphatedehydrogenaseSGN-U209515 (At1 g42970.1) 9.2e-79 AACAACTCACTCCTACACCGG/GGTAGCACTAGAGACACAGCCTT135 1.83 ± 0.09RPS13 Ribosomal protein S13 SGN-U208260 (At4 g00100.1) 4e-77 CAGGCAGGTTAAGGCAAAGC/CTAGCAAGGTACAGAAACGGC114 ... Norm-Finder fits data to a mathematical model, which allowscomparison of intra- and intergroup variation and calcu-lation of expression stability.Using the programs described above researchers...
  • 11
  • 330
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Efficacy of different treatment regimes against setariosis (Setaria tundra, Nematoda: Filarioidea) and associated peritonitis in reindeer" doc

... tundra nematodes in the abdominal cavity in the treated group. In addition,healing processes and the organization of the inflamma-tory changes in the abdominal cavity had clearly startedone month ... AO and AS par-ticipated in the design and coordination of the study and were also active in writing process. TO helped and partic-ipated in statistical analyzes. HN and MN partly coordi-nated ... caused bySetaria tundra appeared in reindeer (Rangifer tarandustarandus) in Finland. The proportion of reindeer calf vis-cerae condemned due to lesions possibly associated with S. tundra in...
  • 9
  • 282
  • 0
báo cáo khoa học:

báo cáo khoa học: " Overdose prevention for injection drug users: Lessons learned from naloxone training and distribution programs in New York City" pdf

... naloxone training included information on naloxone, education about appropriate responses to opi-ate overdose (i.e. calling 911 and performing rescuebreathing) and instructions on naloxone administration(intramuscular ... modifications; e) conducting a formal evaluation; and f) evolution of program responseto naloxone. a. Political climate of naloxone distributionProponents of naloxone administration programs defineopiate ... methods of cooperating with police and medical staff post-naloxone administration and the importance of talking to drug using partnersabout naloxone and overdose response.Harm Reduction Journal...
  • 8
  • 329
  • 0
báo cáo khoa học:

báo cáo khoa học: " Characteristics of successfully implemented telemedical applications" docx

... whichinter alia led to an unacceptable concentration and inap-propriate distribution of health practitioners and exper-tise. Today, health care and expertise are concentrated in the major urban ... planning and implementation,through users' participation in developing the goals and methods of practice, and their involvement in planning and carrying out the implementation. Organization ... implementation depends on teamwork, involving the initiators of the technology as well as the managers, clinicians, and patients5) Issues regarding organisational and technical arrangements are addressedSuccessful...
  • 11
  • 246
  • 0
báo cáo khoa học:

báo cáo khoa học: " Characteristics of inmates witnessing overdose events in prison: implications for prevention in the correctional setting" doc

... Fugelstad A, Stenbacka M, Leifman A, Nylander M, Thiblin I: Metha-done maintenance treatment: the balance between life-sav-ing treatment and fatal poisonings. Addiction 2007,102:406-412.40. Zanis ... methods and results section, and conducted additional literature search. AHV wrote themethod and results section, performed all data analysis,prepared the tables, wrote part of the introduction and conclusions, ... Although with limitedcapacity, the PR Department of Correction and Rehabili-tation has established, since 2002, opiate agonist treat-ment, initially with methadone and recently addingBuprenorphine-naloxone....
  • 8
  • 172
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM