Báo cáo y học: "Incidence of asthma and mortality in a cohort of young adults: a 7-year prospective study" ppt
Báo cáo y học: " Incidence, organ dysfunction and mortality in severe sepsis: a Spanish multicentre study" ppt
... of patients, acquisition, analysis and interpretation of data, and they drafted and revised critically the manuscript. JV wasinvolved in analysis and interpretation of data and he revisedthe manuscript ... associated with mortality were cardiovasculardysfunction in the SOFA score on day 1 and the variableΔSOFA 3-1, defined as the difference in the total SOFAscores on day 3 and on day 1. An increase ... database(Microsoft, Redmond, WA, USA) at the coordinating centre.All data related to physiological and biological variables werechecked against standardised ranges by the medical staff atthe coordinating...
- 14
- 320
- 0
Báo cáo y học: "Self-reported asthma and allergies in top athletes compared to the general population - results of the German part of the GA2LEN-Olympic study 2008" pptx
... r’sdiagnosedasthma: Have you ever had asthma? AND Was this confirmed by a doctor?▪ Current use of asthma medication: Are you cur-rently taking any medicines including inhalers, aero-sols or tablets ... use of asthma medication (1.8;1.0-3.4) and current wheezing or use of asthma Table 1 Prevalence of allergic rhinitis, respiratory symptoms and asthma treatment by population group and sports categoryVariable ... I, Tikkanen H, Haahtela T: Association between type of training and risk of asthma in elite athletes. Thorax 1997, 52:157-60.15. Helenius I, Tikkanen H, Sarna S, et al: Asthma and increased bronchialresponsiveness...
- 6
- 467
- 0
Báo cáo y học: "Incidence, severity, aetiology and type of neck injury in men''''s amateur rugby union: a prospective cohort study" ppt
... first prospective study of neck injury in an amateur men's population sincethe inception of the professional RU era. Via an all inclu-sive injury definition and calculation of game, training and ... Rugby Club.Assoc Prof Peter Thomson (Faculty of Veterinary Science, University of Sydney) for assistance in data analysis.Author DetailsMacquarie Injury Management Group (MIMG), Faculty of ... undertaken using the statistical package GenStat.Associations between outcome measures and player posi-tion, phase of play, aetiology and injury type have beendescribed by means of cross tabulation....
- 12
- 219
- 0
Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx
... FT-IR-spectroscopy; Thermus thermophilus.Cytochrome c oxidase is the terminal enzyme of therespiratory chain in mitochondria and many prokaryotes.As an integral membrane protein it catalyzes the reduction of ... understanding, two pathways are necessary for thecatalytic activity, but different residues may be involved. In an important step for the understanding of the essentials forcytochrome c oxidase activity ... incorporatedbelong to the caa3-andba3-type cytochrome c oxidases,respectively. The caa3-oxidase contains analogous centralsubunits and catalytic entity to the mitochondrial aa3-oxidases,...
- 9
- 528
- 0
Báo cáo y học: "Relationship between Asthma and Rhinitis: Epidemiologic, Pathophysiologic, and Therapeutic Aspects" pps
... have a typical T-helper 2(Th2) cytokine inflammatory pattern as measured in rhino-sinusal lavage. Nonatopic or intrinsicasthmatic patients have an inflammatory patternsimilar to that of atopic ... counts as a marker of disease activity in intrinsic and extrin-sic asthma. Clin Exp Allergy 1995;25:820–7.26. Humbert M. Airways inflammation in asthma and chronic bronchitis. Clin Exp Allergy1996;26:735–7.27. ... MucosaSegmental bronchial allergen challenge in nonasth-matic allergic rhinitis patients leads to a decrease in nasal peak inspiratory flow and a concomitantincrease in nasal symptomatology.31It alsoincreases...
- 7
- 400
- 0
Báo cáo y học: "Cold hands — strained heart? Advances in the management of Raynaud’s phenomenon and pulmonary hypertension" ppt
... bosentansubstantially increases survival, with survival estimates at1 year and 2 years of 96% and 89% compared withViewpointCold hands — strained heart? Advances in the management of Raynaud’s phenomenon and ... possibility that the generalised vasculopathy of SScl mayalso be modifiable. In the characteristic microangiopathy of SScl, luminalnarrowing results from a combination of intimal proliferation,medial ... occurs in approximately 12% of SScl patients [1]. PAHaccounts for approximately 50% of mortality in limited SScl and accounts for approximately 7% of mortality in diffuseSScl. It is probable that...
- 3
- 541
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... GCGATGGTCTCAGAAACCAAACReverse primer: GAGATTACAGAGGAAGTTATCCTCTGCProbe: TGCAGTGAAGGTTGCTGAGGCTCTGAGRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CTReverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTAProbe: ... ATGGTGAATATCATCATGAAAAAGATTCProbe: CATGCTCATTCTCAACCACATCACCAACAH6PDH Forward primer: CAGGTGTCCTAGTGCACATTGACReverse primer: GTAGCCCACTCTCTCGTCCAAProbe: AAGGCACGCCCTCCCAGCGGRα Forward primer: GCGATGGTCTCAGAAACCAAACReverse ... protein.Statistical analysisData are reported as mean ± standard deviation (SD) of repli-cate mean values for separate patient cell cultures. However,because of interindividual variation, data in...
- 10
- 438
- 0
Báo cáo y học: "Epitope spreading to citrullinated antigens in mouse models of autoimmune arthritis and demyelination" pot
... citrullinated tropomyosin 1alpha, actin, calgranulin-B and ATP synthase beta chain (Table1). Immunoblotting and mass spectroscopy analysis of EAEbrain tissue lysates identified citrullinated ATP ... using myelin and synovial antigen arraysCharacterisation of antibody responses in collagen-induced arthritis (CIA) and experimental autoimmune encephalomyelitis (EAE) using myelin and synovial antigen ... antigen arrays. (a, b) Synovial and (d, e) myelin arrays were produced by printing synovial and myelin peptides and proteins in ordered arrays on the surface of microscope slides. The arrays were...
- 12
- 364
- 0
Báo cáo y học: "Homoeolog-specific retention and use in allotetraploid Arabidopsis suecica depends on parent of origin and network partners" doc
... expressionbetween At, Aa, and F1As. More than 15% of transcriptsAT1G65450.1GGTTTTAACCGCATACGCAAAGGAGAAATG CAAGGC ATTGCTTGAAGA GCCGTT TGGGAGGATTGT AGAAAT GGTAGG AGAAGGGTCAAA GAGGAT AACGGA TGAGTAT GCGCGGTCT ... T. G G A T T .G T C .G G A T T G T T C .G G A T. T .G T . GCAGTTTTAACTGCTTACGCAAAGGCGAAATG CAAGGC ATTGCTTGAAGA GCCGTT TGGGAGGATTGT GGAAAT AGTAGG TGATGGGGCAAA TAGGAT AACGGA TGAGTAT GCGCGGTCT ... within Aa and AtNote that although extant accessions of Aa, At,andF1Aswere used, As wasformed12to300KYA,perhapsfromdifferent accessi ons. DFs and Illumina resequencing maypotentially result...
- 17
- 336
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ