Báo cáo y học: "Infliximab in ankylosing spondylitis: alone or in combination with methotrexate? A pharmacokinetic comparative study" ppt
Báo cáo y học: "Infliximab in ankylosing spondylitis: alone or in combination with methotrexate? A pharmacokinetic comparative study" ppt
... this article as: Mulleman et al .: Infliximab in ankylosing spondylitis: alone or i n combination with meth o trexate? A ph a rmacokinetic comparative study. Ar thritis R esea rch & Therapy ... concentrationbetween baseline and week 18 (AUC0-18). Clinical and laboratory evaluations were performed at each visit. The Bath Ankylosing Spondylitis Disease Activity Index (BASDAI) score was ... for AS with predominantlyaxial symptoms.Data comparing infliximab with and without MTXtreatment in AS are sparse and conflicting. Pérez-Guijoet al. [7] found a greater reduction in Bath Ankylosing Spondylitis...
- 5
- 364
- 0
Báo cáo y học: " Rehabilitation program for traumatic chronic cervical pain associated with unsteadiness: a single case study" potx
... ofthe manuscript. DL, AC and RC undertook sensorimotorassessment and data analysis. MD performed all clinicalevaluations. All authors have read and concur with thefinal manuscript. They also accept ... purposes)Chiropractic & OsteopathyOpen AccessCase reportRehabilitation program for traumatic chronic cervical pain associated with unsteadiness: a single case studyDanik Lafond*1, Annick Champagne1, ... rosalie.cadieux@uqtr.ca; Martin Descarreaux - martin.descarreaux@uqtr.ca* Corresponding author AbstractBackground: Neck problems are often recurring or chronic. After pain, unsteadiness and balanceproblems...
- 10
- 410
- 0
Báo cáo y học: "Therapy of ankylosing spondylitis and other spondyloarthritides: α established medical treatment, anti-TNF-α therapy and other novel approaches" pps
... antibody; AS = ankylosing spondylitis; ATTRACT = Anti-TNF Trial in Rheumatoid Arthritis with Comcomitant Therapy; BASDAI =Bath Ankylosing Spondylitis Disease Activity Index; BASFI = Bath Ankylosing ... drugsNonsteroidal anti-inflammatory drugs (NSAIDs) and intra-articular coriticosteroids are accepted, often-used treat-ments for AS [13]. NSAIDs are taken, with varyingefficacy, by about 70–80% of AS patients. ... ofsulfasalazine in early AS and undifferentiated SpA.Much less information is available about the efficacy ofother DMARDs in AS. Since very early occasional reports[28], there have been a few...
- 15
- 301
- 0
Báo cáo y học: "Therapy of ankylosing spondylitis and other spondyloarthritides: α established medical treatment, anti-TNF-α therapy and other novel approaches" pdf
... antinuclear antibody; AS = ankylosing spondylitis; ATTRACT = Anti-TNF Trial in Rheumatoid Arthritis with Comcomitant Therapy; BASDAI =Bath Ankylosing Spondylitis Disease Activity Index; BASFI ... D, Bellamy N, Calin A, Dougados M, Khan MA, vander Linden S: Preliminary core sets for endpoints in ankylosing spondylitis. Assessments in Ankylosing Spondylitis WorkingGroup. J Rheumatol 1997, ... ankylosing spondylitis; BASDAI, Bath Ankylosing SpondylitisDisease Activity Index; DMARD, disease-modifying antirheumatic drug;NSAID, nonsteroidal anti-inflammatory drug.Table 3Anti-TNF therapy...
- 15
- 266
- 0
Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"
... mg naringin Group 5: Advantra Z® with 1,000 mg hesperidin and 600 mg naringin After remaining seated and resting for 45 min., participants completed a second self report rating scale. After ... P, Chaudhuri A, et al. Orange juice or fructose intake does not induce oxidative and inflammatory response. Diabetes Care 2007; 30: 1406-1411. 13. Ghanim H, Sai CL, Upadhyay M, et al. Orange ... response to p-synephrine or p-synephrine in combination with naringin and hes-peridin (Table 2). p-Synephrine differs from ephedrine in that it has a hydroxyl group on the para position of...
- 7
- 641
- 0
Báo cáo y học: "Individual and occupational risk factors for knee osteoarthritis: results of a case-control study in Germany" pdf
... transformed into categorical variables for betterrepresentation. A further reason for the transformationinto categorical variables was the fact that the metricparameters only rarely showed a ... mentioned above.Symptomatic knee OA and smokingThe factor of smoking (here measured in package-years)was negatively associated with symptomatic knee OA in women (smoking >20 package-years). ... loads was mentioned in the questionnaire by cases or controls in order toobtain more detailed information about the individual'swork tasks.Patient recordThe patients' history and...
- 15
- 322
- 0
Báo cáo y học: "Membrane transporters and protein traffic networks differentially affecting metal tolerance: a genomic phenotyping study in yeas" potx
... 5'-(CGCGGACCGTTAACTGATATCACCATGAGACATG)-3'SMF2 Forward 5'-(CGCGGTCCGCTACGTAGCCACCATGACGTCCCAAGAATATGAACC)-3'SMF2 Reverse 5'-(CGCGGACCGTTAGAGGTGTACTTCTTTGCCCG)-3'SMP1 Forward 5'-(CTCGGTCCGCCACCATGGGTAGAAGAAAAATTGAAATTGAACC)-3'SMP1 ... Forward 5'-(CTCGGTCCGCCACCATGTTTTACCCATATAACTATAGTAAC)-3'NRG1 Reverse 5'-(CTCGGACCGTTATTGTCCCTTTTTCAAATGTGTTC)-3'PHO88 Forward 5'-(CGCGGTCCGCTACGTAGCCACCATGAATCCTCAAGTCAGTAACATC)-3'PHO88 ... Szczypka M, Thiele DJ, Rea PA: A new path-way for vacuolar cadmium sequestration in Saccharomycescerevisiae: YCF1-catalyzed transport ofbis(glutathionato)cadmium. Proc Natl Acad Sci USA 1997,94:42-47.11....
- 19
- 252
- 0
Báo cáo y học: "Protein, iron, and meat consumption and risk for rheumatoid arthritis: a prospective cohort study" pps
... RA, rather than until the dateof RA diagnosis. We also performed lagged analyses suchthat the dietary intakes associated with RA cases wereassessed at least 4 years before the date of diagnosis. ... well as for the same variables adjusted for in all the multivariate models. dAll P values for trend were calculated with median intake of each nutrient in each quintile as a continuous variable. ... breastfeeding for all children in 1986, and regularityof menses from age 20 to 35 years (very regular, usually regu-lar, usually irregular, and very irregular) in 1982.Statistical analysesThe...
- 8
- 340
- 0
Báo cáo y học: " Primary hepatic lymphoma presenting as fulminant hepatic failure with hyperferritinemia: a case report" ppt
... hepatitis B, C and Epstein-Barr have beenimplicated. Signs and symptoms can mimic a variety ofinfectious and inflammatory disorders delaying the diag-nosis. A preliminary diagnosis of AOSD was ... weightloss, myalgias and arthralgias. She had mild epigastric dis-comfort with nausea and vomiting. Dalteparin and warfa-rin were started for a recently diagnosed pulmonaryPublished: 19 August 2008Journal ... case of a middle-aged woman exhibiting pancytopenia, hyperferritinemia andrapidly deteriorating to develop acute hepatic failure. Her initial clinical picture led to a workingdiagnosis of adult...
- 4
- 269
- 0
Báo cáo y học: "Acute atomoxetine treatment of younger and older children with ADHD: A meta-analysis of tolerability and efficacy" ppsx
... attention-deficit/hyperactivity disorder; ADHD-RS: ADHD Rating Scale-IV; AE: adverse event; ANCOVA:analysis of covariance; ANOVA: analysis of variance; ATX:atomoxetine; CGI-ADHD-S: Clinical Global Impressionof ... weight, vital signs, corrected QT interval, andlaboratory parameters, treatment difference within eachage category was assessed using an ANOVA model with a treatment term. Consistency of treatment ... regarding the safety and efficacy of phar-macotherapy for ADHD in children under the age of 8.The current analysis takes advantage of the growing data-base from multiple clinical trials of ATX...
- 9
- 415
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ