Báo cáo y học: " The role of γδ T cells in airway epithelial injury and bronchial responsiveness after chlorine gas exposure in mice" pps
Báo cáo y học: " The role of γδ T cells in airway epithelial injury and bronchial responsiveness after chlorine gas exposure in mice" pps
... hyperresponsiveness and exhibit an attenuated inflammatory response. The contri-bution of γδ T cells to epithelial regeneration in the intes-tine is not evident in the airways.Competing interests The author(s) ... inflammatoryresponse to acute epithelial injury and in maintaining and repairing the epithelial barrier [16]. Chen et al. havefound that a deficiency of γδ T cells rendered the intestinalepithelium of mice more ... in the wild type but not the knockout mice after chlorine exposure, consistent with the difference in the magnitude of the inflammatoryresponse in the two study groups. Differences in levels of constitutive...
- 11
- 300
- 0
Báo cáo y học: "The role of T cell interleukin-17 in conducting destructive arthritis: lessons from animal models" pps
... phenotypically [27,28]. These studies indicate the existence of an IL-23/IL-17 axis of communication between the innate and adaptive parts of the immune system thatmight be an interesting target ... 1). Role of IL-17 in T cell immunity and/ orpropagation of joint inflammation In arthritis, IL-17 is a pro-inflammatory cytokine thought tocontribute to the joint inflammatory process [38]. Studies in ... the prevention of joint destruction as an adjunct to anti-TNF and anti-IL-1 therapy.Competing interests The author(s) declare that they have no competing interests.AcknowledgementsThis work...
- 9
- 294
- 0
Báo cáo y học: "The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles" pot
... purposes)gastrocnemius and the fast-twitch EDL muscles. We alsodemonstrate that muscle fibre type, and mouse strainindependently, determined susceptibility to IR injury. The susceptibility of different ... exhibit differentsusceptibilities. The relative degree of mast cell mediated injury, within different muscle types, isnot known.Methods: In this study we compared susceptibility of the fast-twitch, ... slow/fast-twitch (gastrocnemius) and fast-twitch (EDL) types, and compared their susceptibility to IR injury in four genotyp-ically different sets of mice that harbour different mast celldensities in their...
- 7
- 400
- 0
Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc
... T reg cells does reflect their more activatedphenotype, and their ability to enter inflamed joints makes itpossible that they act directly at the site of inflammation.DiscussionOur findings ... With this in mind, itcould be interesting to investigate whether the accumu-lated T reg cells in patients with arthritis function properly in vivo and whether these patients could really benefit ... correct, then they could explainwhy the transfer of T reg cells after arthritis induction is noteffective. On the one hand, transfer of T reg cells 24 hours after intra-articular antigen...
- 11
- 440
- 0
Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx
... motifs, one at the N- and the otherat the C- terminus [20]. p21/waf1 (mut) is mutated at the N-terminus and is therefore still able to bind to cyclinsthrough the C-terminus, making this protein ... within the Nterminus and the other at the C terminus [20]. p21/waf1interacts with both cyclins and cdks, in contrast to the INKfamily CDKI members, which only bind to cdks [20].Interestingly, ... [28,30]. Tax also has the abil-ity to increase cdk4 associated kinase activity in HTLV-1infected cells by binding to p16/INK4A, resulting in the inability of p16/INK4A to effectively inhibit cyclin...
- 17
- 299
- 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTGReverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATTP74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTACReverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGCQ76G ... contains threedomains resembling family 2 cystatins.Cystatins competitively inhibit the activity of papain-like cysteine proteases by binding to the active site of the latter and forming a tight, ... role of the second binding loop of cystatin A in the inhibition of this enzyme. Pro74 may bedirectly involved in the interaction with cathepsin B byproviding hydrophobic interactions with the...
- 10
- 533
- 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf
... volume of the acyl binding pocket and thereby alter the binding mode and affinity of the enzyme for PAA and derivatives thereof, while maintaining the hydrophobicity of the binding site.To test the ... constants for the deacylation reaction in the active site of the acyl-enzyme have been changed by the bF24Amutation. The rate-limiting step in the synthesis reaction is the acylation of the enzyme ... effect of the mutations on the specificity forphenylacetylated substrates, the steady-state kinetic param-eters for the hydrolysis of the chromogenic substrateNIPAB and the inhibition constant of...
- 8
- 561
- 0
Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc
... finding that both MtaA mutants still bindcoenzyme M and exhibit some activity although in bothmutants the coordination of zinc differs from the situation in the wild-type enzyme. Apparently, other ... of the thiol group as shown by the release of aproton upon binding of the substrate to the zinc enzyme[21].MtaA does not share sequence similarity to any of the other zinc enzymes catalyzing ... apparentabsence of any sulfur in the first coordination sphere of Zn in the Cys239 fi Ala mutant suggests that Cys316 is not adirect Zn ligand in MtaA. It would be interesting toinvestigate the...
- 7
- 464
- 0
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... consistent with the proposed roles for these residues in binding the carboxylate linked to the nucleus of penicillin N(Arg160 and Arg162) and the carboxylate of the a-amino-adipoyl side-chain ... substrate, and may be a consequence of the higher Kmvalue for this substrate [1,22]. The third type of mutant,represented by arginines 306 and 307, are located in the C-terminus. They appear to ... [12,13]suggest that correct orientation of the penicillin substratewith respect to the putative high-energy ferryl intermediateis important for optimum coupling between 2-oxoglutarate and penicillin...
- 5
- 462
- 0
Báo cáo y học: "The role of Probiotics in allergic diseases" pptx
... as the timing of the introduction of the probiotic, Taylor et al administered the probiotic supplement postnatally, while other studiesadministered probiotics before and after birth. Prenatalsupplementation ... in allergic disorders The interest in probiotic therapeutic potential in allergicdisorders stemmed from the fact that they have beenshown to reduce inflammatory cytokines and improveintestinal ... family history of eczema,allergic rhinitis or asthma, and to their infants for the firstsix months after delivery. The frequency of developingatopic dermatitis in the offspring was significantlyreduced...
- 7
- 560
- 0
Từ khóa: the role of mesenchymal cells in cancer contribution to tumor stroma and tumorigenic capacitythe role of immune cells in the tumor microenvironmentbáo cáo y họcbáo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenthe role of t antigen and insulin like growth factor 1 in dna repair fidelitythe role of t regwhat is the role of positive feedback in the endocrine systemthe role of positive feedback in homeostasisdescribe the role of data networking in communicationsthe role of critical thinking in educationthe role of critical thinking in problem solvingBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ