báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... using the following primers: LTA-1F, 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA GGGG-3Â ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwat...
Ngày tải lên : 18/02/2014, 17:20
  • 11
  • 873
  • 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayar- aman L (2008) Pyrazole inhibitors of coactivator associ- ated arginine methyltransferase 1 (CARM1). ... PRMTs catalyze monomethylation as a reaction intermediate [4]. Post-translational modifications within T -cell- recep- tor signaling cascades allow T lymphocytes to initiate a rapid...
Ngày tải lên : 06/03/2014, 11:20
  • 13
  • 646
  • 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 ... CCCGCTCGAGTCTTAGAATTATTGAGAACG 3 GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TTTTGTCGACATGGCGCAACA...
Ngày tải lên : 16/03/2014, 01:20
  • 9
  • 444
  • 0
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... buffer. P. Shahi et al. Thioesterase of Alcaligenes faecalis FEBS Journal 273 (2006) 23742387 ê 2006 IMTECH 2381 Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis Puja ... USA. Bacterial strain The strain isolated from soil samples was identified as a bacterium, A. faecalis according to Bergey’s Manual [31], and was desig...
Ngày tải lên : 16/03/2014, 13:20
  • 14
  • 513
  • 0
Báo cáo khoa học: "Development of a Stemming Algorithm" pdf

Báo cáo khoa học: "Development of a Stemming Algorithm" pdf

... sonal communication]) or mathematical analysis of a body of language, often require matched stems. (So does stemming as part of an information-retrieval sys- tem, the specific application ... of Chicago, Department of Lin- guistics. variety of applications are considered in evaluating the theoretical and practical attributes of several previous algorithms. As a ma...
Ngày tải lên : 16/03/2014, 19:20
  • 10
  • 360
  • 0
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

... into the forward primer (5Â-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3Â), and a BamHI site (bold) was introduced into the reverse primer (5Â-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3Â) to facili- tate vector–insert ... University, Canberra, Australia A new baculovirus-based fluorescence resonance energy transfer (Bv-FRET) assay for measuring multimerization of cell surface mole...
Ngày tải lên : 30/03/2014, 20:20
  • 9
  • 380
  • 0
Báo cáo khoa học: "Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application" potx

Báo cáo khoa học: "Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application" potx

... 337–343 Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application Deog Yong Lee, Young Wook Cho, Sang Gyun Kang, Sung Jae Shin, Han Sang Yoo* Department of Infectious ... interferon-gamma in response to mitogen, superantigen and recall viral antigen. Vet Immunol Development of a novel antigen capture-ELISA...
Ngày tải lên : 07/08/2014, 18:20
  • 7
  • 400
  • 0
Báo cáo khoa học: " Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies" potx

Báo cáo khoa học: " Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies" potx

... Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies 43 washing, 100 à l of each HRP conjugated MAb was added into each well and incubation ... sensitivity and specificity of the sandwich ELISA for screening Listeria spp. using different sets of flagella specific antibody combinations. Materia...
Ngày tải lên : 07/08/2014, 18:21
  • 6
  • 388
  • 0
Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps

Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps

... article Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stands Gerhard Struck and Achim Dohrenbusch* Institute of Silviculture, Department ... plants ha –1 7455 plants ha –1 “wide spaced” ASIX – A new branch index 817 as a raw material source. But we found no similar quo...
Ngày tải lên : 08/08/2014, 14:22
  • 8
  • 315
  • 1
Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

... is of Mexican origin. The index case was a 23-year-old female diagnosed with breast carci- noma of the left breast with combined histological fea- tures of lobular carcinoma and infiltrating ... Journal of Surgical Oncology Open Access Research Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni s...
Ngày tải lên : 09/08/2014, 04:21
  • 7
  • 403
  • 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

... (principal component analysis and isomap method) Brain plan evaluation for (a) ANFIS and (b) human planFigure 7 Brain plan evaluation for (a) ANFIS and (b) human plan. The DVHs are shown in (c). ANFIS ... TPS at the level of deliverable plans Prostate plan evaluation for (a) ANFIS and (b) human planFigure 6 Prostate plan evaluation for (a) ANFIS and (b) human plan. The DVHs are show...
Ngày tải lên : 09/08/2014, 10:20
  • 16
  • 510
  • 0
Báo cáo khoa học: " Development of a novel monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strains" docx

Báo cáo khoa học: " Development of a novel monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strains" docx

... first demonstration of a monoclonal antibody, specifically designed to be reactive against multiple VEEV strains, Reactivity of phagemid clones to a wide range of VEEV strainsFigure 1 Reactivity of phagemid ... monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strains Lyn M O'Brien*, Cindy D Un...
Ngày tải lên : 12/08/2014, 04:21
  • 9
  • 290
  • 0
báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf

báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf

... J, Nakamura M, Hirozane-Kishikawa T, Kanagawa S, Arakawa T, Taka- hashi-Iida J, Murata M, Ninomiya N, Sasaki D, Fukuda S, Tagami M, Yamagata H, Kurita K, Kamiya K, Yamamoto M, Kikuta A, Bito T, Fujitsuka ... T, Fujitsuka N, Ito K, Kanamori H, Choi I, Nagamura Y, Matsumoto T, Murakami K, Matsubara K, Carninci P, Hayashizaki Y, Kikuchi S: Gene organization in rice revealed by full-length...
Ngày tải lên : 12/08/2014, 05:20
  • 10
  • 397
  • 0

Xem thêm

Từ khóa: