Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt

Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt

Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt

... that vaccination of mice orally with the Salmonella vaccine vector induced systemic Gag-spe- cific Th1 and Th2 cytokine responses. Oral vaccination of mice with recombinant Salmonella induces Gag-specific ... Elecsys ® HIV p24 Ag assay (Roche) according to manufacturer's recommendations. Salmonella vaccine stocks Stocks of recombinant Salmonella bacteria...
Ngày tải lên : 12/08/2014, 04:21
  • 9
  • 217
  • 1
Báo cáo y học: " Initial experience with a synthetic sealant PleuraSeal™ after pulmonary resections: a prospective study with retrospective case matched controls" docx

Báo cáo y học: " Initial experience with a synthetic sealant PleuraSeal™ after pulmonary resections: a prospective study with retrospective case matched controls" docx

... Brunelli A, Xiume F, Al RM, Salati M, Marasco R, Sabbatini A: Air leaks after lobectomy increase the risk of empyema but not of cardiopulmonary complications: a case-matched analysis. Chest 2006, ... difficult to access by standard suturing or fleece-bond sealants, PleuraSeal™ as a liquid sealant is ideal to seal air leaks in this interlobar space with its many anatomical variations...
Ngày tải lên : 10/08/2014, 09:22
  • 9
  • 214
  • 0
Báo cáo y học: " Oral involvement in a case of AA amyloidosis: a case report" pps

Báo cáo y học: " Oral involvement in a case of AA amyloidosis: a case report" pps

... caused by the amyloidosis. Introduction Reactive systemic AA amyloidosis, with a sustained acute phase response (APR), can complicate chronic inflamma- tory disorders. AA amyloid fibrils are derived ... approximately 45% of all cases of systemic amyloidosis, has been associ- ated with various chronic inflammatory conditions such * Correspondence: dtinanc@mynet.com 1 Zonguldak Karae...
Ngày tải lên : 11/08/2014, 12:20
  • 6
  • 346
  • 0
Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc

Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc

... and pathogenicity Lesley J Mason 1 , Anastasia Lambrianides 2 , Joanna D Haley 2 , Jessica J Manson 1 , David S Latchman 2 , David A Isenberg 1 and Anisur Rahman 1 1 Centre for Rheumatology, ... possibility. Introduction Systemic lupus erythematosus (SLE) is an autoimmune rheu- matic disease of unknown aetiology, characterised by the presence of autoantibodies against a multiplicity o...
Ngày tải lên : 09/08/2014, 06:23
  • 13
  • 472
  • 0
Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot

Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot

... signifi- cantly enhanced stimulatory capacity in mixed leukocyte culture and the ability to promote CD8 T cell expansion and cytolytic capacity. Therefore, this approach yields malignant cell loaded ... apoptotic cells found in co-cultures of a: CD8 T cells and DC loaded with apoptotic malignant T cells; b: CD8 T cells, DC and viable CTCL cells; c: DC loaded with apoptotic CTCL in the...
Ngày tải lên : 11/08/2014, 10:23
  • 16
  • 251
  • 0
Báo cáo y học: "Clinical aspects of a nationwide epidemic of severe haemolytic uremic syndrome (HUS) in children" ppt

Báo cáo y học: "Clinical aspects of a nationwide epidemic of severe haemolytic uremic syndrome (HUS) in children" ppt

... The clinical course was characterized by an aggressive disease with significant extrarenal complica- tions. In Norway there are five University Hospitals with paediatric departments, all in close ... diarrhea- associated hemolytic uremic syndrome: a systematic review and meta- analysis. Diabetes Care 2005, 28:2556-2562. 21. Gallo EG, Gianantonio CA: Extrarenal involvement in diarrhoea-a...
Ngày tải lên : 13/08/2014, 23:20
  • 6
  • 288
  • 0
Báo cáo y học: "Comparative biochemical analysis of recombinant reverse transcriptase enzymes of HIV-1 subtype B and subtype " ppt

Báo cáo y học: "Comparative biochemical analysis of recombinant reverse transcriptase enzymes of HIV-1 subtype B and subtype " ppt

... 5’-TTAAAAGAAAAGGGGGG-3’; pp57D, 5’-CGTTGGGAGTGAATTAGCCCTTCCA- GTCCCCCCTTTTCTTTTAAAAAGTGGCTAAGA-3’; kim40R, 5’-AAGCTTGGCTGCAGAATATTGCTAG- CGGGAATTCGGCGCG-3’; kim32D, 5’-CGCGCCGAATTCCCGCTAGCAATAT- TCTGCAG-3’; Tenofovir ... 3 ’- GACGTCTTATAACGATCGCCCTTAAGCCGCGC - 5 ’ -1 -10 -20 Kim40R 5’-AAGCUUGGCUGCAGAAUAUUGCUAGCGGGAAUUCGGCGCG-3’ Kim32D 3 ’- GACGTCTTATAACGATCGCCCTTAAGCCGCGC - 5 ’ RNase H activi...
Ngày tải lên : 13/08/2014, 01:20
  • 11
  • 241
  • 0
Báo cáo y học: " Effects of the K65R and K65R/M184V reverse transcriptase mutations in subtype C HIV on enzyme function and drug resistance" pps

Báo cáo y học: " Effects of the K65R and K65R/M184V reverse transcriptase mutations in subtype C HIV on enzyme function and drug resistance" pps

... gel-based assays with HIV-1 PBS RNA template and tRNA3 Lys as primer. Single-cycle processivity was assayed under variable dNTP concentrations. Steady-state analysis was performed to measure ... activities are expressed as a percentage of subtype B wild-type RT specific activity. (C) Incorporation efficiency of TFV-DP by subtype C WT and mutant RTs was monitored by gel-based as...
Ngày tải lên : 13/08/2014, 05:21
  • 11
  • 255
  • 0
Báo cáo y học: "Co-existence of a giant splenic hemangioma and multiple hepatic hemangiomas and the potential association with the use of oral contraceptives: a case report" potx

Báo cáo y học: "Co-existence of a giant splenic hemangioma and multiple hepatic hemangiomas and the potential association with the use of oral contraceptives: a case report" potx

... hematoma. Angiographic appearance of cavernous splenic hemangiomaFigure 2 Angiographic appearance of cavernous splenic hemangioma. 1. Splenic artery (black arrows). 2. Celiac trunk (white arrow). Journal ... with multiple hepatic hemangiomas. Pathogenetic mechanisms between hemangiomas and oral contraceptives, as well as therapeutic approaches, are analyzed in this case report, in parti...
Ngày tải lên : 11/08/2014, 23:21
  • 5
  • 384
  • 0
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx

Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx

... EGFP–N2-hspry4, composed of vector EGFP-N2 (Clontech, Palo Alto, CA, USA) and hspry4 cDNA, was constructed with primers: 5¢-TTA GGATCCATGCT CAGCCCCCTCCCC-3¢ forward and 5¢-G GAATTC TCCGAAAGGCTTGTCGG-3¢reverse, ... protein concentrations as determined by BCA assay (Bio-Rad). Yeast two-hybrid assay Full-length human sprouty 4 cDNA was amplified by PCR with forward primer 5¢-CTA GTCGACATGCT...
Ngày tải lên : 31/03/2014, 15:20
  • 11
  • 542
  • 0

Xem thêm

Từ khóa: