Báo cáo khoa học:" Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pptx
Báo cáo khoa học:" Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pptx
... both avian lineages(Av1 and Av2) have been seen sporadically in humans,they have not been maintained in the population (bluecharacters in Av1 and Av2, Figure 1A and 1F). Strains with the M gene ... different hosts and host adaptation.Background The influenza virus is a common cause of respiratoryinfection all over the world. The influenza A virus caninfect not only humans but also avian, swine, ... suzukia@mail.tains.tohoku.ac.jp; Taro Kamigaki - kamigakit@mail.tains.tohoku.ac.jp; Hitoshi Oshitani* - oshitanih@mail.tains.tohoku.ac.jp* Corresponding author AbstractBackground: Influenza A virus...
- 13
- 342
- 0
Tài liệu Báo cáo khoa học: "Computationally Efficient M-Estimation of Log-Linear Structure Models∗" doc
... think of −w as the parameters of a processthat “damage” the true model p∗, producing q0, and the estimation of w as learning to undo that damage. In the remainder of the paper, we use the ... 2; the different methods behave relatively similarly as the training data are reduced. Fig. 3 plots accuracy(on tuning data) against training time, for a vari-ety of training dataset sizes and ... computedfor training, and q0(x, y) is a factor in the modelused in decoding.If q0is a familiar stochastic grammar, such as anHMM or a PCFG, or any generative model fromwhich sampling is straightforward,...
- 8
- 286
- 0
Báo cáo khoa hoc:" N-acetylcysteine lacks universal inhibitory activity against influenza A viruses" doc
... show thatNAC is unable to alter the course of a fatal influenza pneumonia caused by inoculation of a murinized swine H1N1 influenza virus. NAC was indeed able to inhibit the swine virus in vitro ... the analysis andinterpretation of data, and drafted the manuscript. All authors read andapproved the final manuscript.Competing interests The authors declare that they have no competing interests.Received: ... Garigliany MM, Habyarimana A, Lambrecht B, Van de Paar E, Cornet A, vanden Berg T, Desmecht D: Influenza A strain-dependent pathogenesis in fatal H1N1 and H5N1 subtype infections of mice. Emerg...
- 4
- 57
- 0
Báo cáo khoa học: Evolution of the teleostean zona pellucida gene inferred from the egg envelope protein genes of the Japanese eel, Anguilla japonica potx
... envelope. The protein names deter-mined after sequence analyses of the cDNAs are indicated in parentheses. The numbers in parentheses at the end of each sequence indicate the position of the amino acid ... 4). The cDNAs were named based on sequence similarities of the ZP domains according to the nomen-clature of Spargo and Hope [10]. The amino acid sequence of the ZP domain of the 37 kDa protein(eSRS3) ... TACGACAGCCAATGCCAGGATezpca Forward: GGAAAGGAACAGTGGGTTAGTReverse: ATCAGCCGCCAAAGTGCCAGGezpcb Forward: GGGAAGGAACGGTGGATTGAGReverse: CTGCATTCAGAGGGCTAATGGezpcc Forward: GGAACTCAACGGTGGATTAGTReverse: CTCTACCACCAAGTGTTGGCTezpcd...
- 11
- 436
- 0
Báo cáo khoa học: "Evolution of the epicormic potential on 17-year-old Quercus petraea trees: first results" doc
... ismanaged by ONF (Office National des Forêts). The siteis at an altitude of 121 m, has a soil composed of loamysand, an average annual temperature of 11oC and an av-erage annual precipitation ... relatedmainly to their death rather than their development intoepicormic shoots. Thus, this evolution of the epicormicpotential has a favourable effect on the preparation of the timber quality ... establishes a relationship between the number of trees and their average quadratic diameter,i.e. the diameter of the intermediate tree. The value indexvaried from 0 to 1, thus a dense stand...
- 10
- 445
- 0
báo cáo khoa học: "Speciation burst hypothesis : an explanation for the variation in rates of phenotypic evolution" pps
... verte-brate fossils appear some 2 to 4 million years early ». In research dealing with 131 species of Benthic Foraminifera on the AtlanticContinental Margin of North America, ... equator.HicxEY et al. (1983) found that new forms of animals and plants first appeared in the Arctic and migrated later to temperate climes. They report that data from ... evolutionary rates and at timesperiods of seemingly random rapid acceleration. The speciation burst hypothesis offers a supported explanation of the variability of rates as being...
- 7
- 363
- 0
báo cáo khoa học: " Evolution of the C4 phosphoenolpyruvate carboxylase promoter of the C4 species Flaveria trinervia: the role of the proximal promoter region" docx
... -430 TCAAAAGAGTAAACAAAAGAGGAAAAAGACTGAT TATTAATATAATAATAATATCCACAAAAATATTCGAATGCTTCAAGCCTAAGTTTGCTppcA-Fbr -423 TCAAAAGAATAAAACATAGAGGAAAAAGACTGAT TATTAATTTAATAATAATATCCACAAAAATATTCCAATAATTCAACCCTGAGTTTGCTppcA-Fpub ... TATTAATTTAATAATAATATCCACAAAAATATTCCAATAATTCAACCCTGAGTTTGCTppcA-Fpub -435 TCAAAAGAGTAAAAAATAGAGGAAAAAGACTGAT TATTAATTTAATAATAATATCCACAAAAATATTCCAATAATTCAACCCTGAGTTTGCTppcA-Fc -450 TACTAAGAGTAAAAAATAGAAGTAAAAGACTGAT TATCAATTTAATAATAATATCCACAAAAATATTCCAATAATTCAACCCTGAGTTTGCTppcA-Fp ... TCAAAAGAGTAAACAAAAAAGGAAAAAGACTAATTATTTAG ATAATAATAATATCCACAAAAATATTCGAATTCTTCAATCCTGAGTTTGCTppcA-Fb -433 TCAAAAGAGTAAACAAAAAAGGAAAAAGACTGATTATTAATATAATAATAATAATATCCACAAAAATATTCGAATTCTTCAATCCTGAGTTTGCTppcA-Fv...
- 8
- 331
- 0
Tài liệu Báo cáo khoa học: Molecular and cellular specificity of post-translational aminoacyl isomerization in the crustacean hyperglycaemic hormone family docx
... Fujisawa Y, Ikeda T, Nomoto K, Yasuda-Kamatani Y,Minakata H, Kenny PT, Kubota I & Muneoka Y(1992) The FMRFamide-related decapeptide of Mytiluscontains a D-amino acid residue. Comp Biochem ... structures and the neuroendocrine complex (X organ–sinus gland). R, retina; LG, lamina ganglionaris; ME, medulla externa; MI,medulla interna; MT, medulla terminalis. (A) General view of X organ labelled ... 91–95.53 Morishita F, Nakanishi Y, Kaku S, Furukawa Y, OhtaS, Hirata T, Ohtani M, Fujisawa Y, Muneoka Y &Matsushima O (1997) A novel D-amino-acid-containingpeptide isolated from Aplysia heart....
- 13
- 687
- 0
Tài liệu Báo cáo khoa học: Substrate specificity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt
... and quantification of all amines [indolyl-3-methanamine (3), N¢-methy-lindolyl-3-methanamine (7), tryptamine (9), 1-naph-thylmethanamine (18) and 2-naphthylmethanamine(20)]. HPLC analysis of ... these analysesindicated that brassinin was enzymatically transformedinto 3-indolylmethanamine (3), carbonyl sulphide andmethanethiol. The chemical mechanism of dithiocarbamate hydro-lysis catalysed ... analysisBrassinin (1), indolyl-3-methanamine (3), 1-methyl-brassinin (4), N¢-methylbrassinin (6), N¢-methylindolyl-3-methanamine (7), methyl tryptaminedithiocarbamate(8), tryptamine (9), brassitin (10),...
- 17
- 595
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam