Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot
Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot
... multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolateMalachy Ifeanyi ... Traavik T: Recombinant viruses obtained from co-infection in vitro with a live vaccinia-vec-tored influenza vaccine and a naturally occurring cowpox virus display different plaque phenotypes and ... viruses obtained from co-infection of cells with MVA vectored influenza vaccine and a naturally circulating cowpox virus displayed paren-tal, but also potentially important non-parental character-istics,...
- 13
- 377
- 0
Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps
... Traavik T: Recombinant viruses obtained from co-infection in vitro with a live vaccinia-vec-tored influenza vaccine and a naturally occurring cowpox virus display different plaque phenotypes and ... confirmed that co-infecting in vitro a Modified vaccinia virus Ankara (MVA) strain engineered to express influenza virus haemagglutinin (HA) and nucleoprotein (NP) genes with a naturally occurring cowpox ... isolated and genetically mapped recombinant viruses obtained from co-infection of cells with a transgenic MVA strain (MVA-HANP) engineered toexpress the influenza virus haemagglutinin (HA) and nucleoprotein...
- 13
- 294
- 0
Báo cáo khoa học: " Risk factors for retained placenta and the effect of retained placenta on the occurrence of postpartum diseases and subsequent reproductive performance in dairy cows" potx
... describe calving condition, parity,gestation length, and calving season. In order to evaluate theinfluence on development of retained placenta of abnormalpartus (total cases of dystocia, caesarean ... diagnosed byclinical signs observed by the veterinarian and/ or farmerwithin 4 weeks postpartum. Abomasal displacement wasdiagnosed by a pinging sound upon abdominal auscultationby a veterinarian, ... +82-43-2673150E-mail: illhwa@cbu.ac.krRetained placenta in dairy cows: Risk factors and effects 55placenta among individual farms were compared using thechi-square test.Evaluation of the effect of retained...
- 7
- 465
- 1
Báo cáo khoa học: "Glutamine induces heat-shock protein and protects against Escherichia coli lipopolysaccharide-induced vascular hyporeactivity in rats" pdf
... catecho-lamine vasoconstrictors and that the effect of Ala-Gln is asso-ciated with its capacity to induce HSP70 expression and attenuate release of pro-inflammatory cytokines and oxidizingspecies ... pathophysiological state, and despite considerable therapeutic advances, it remains a majortherapeutic challenge with a high incidence of mortality [1].Vascular hyporeactivity to catecholamine ... soft-ware (GraphPad Software, Inc., San Diego, CA, USA). Thevalues of PE Emax and median effective dose (EC50) weredetermined for each treatment group. Data are presented asmean ± standard...
- 7
- 162
- 0
Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf
... subline was obtained by sequential exposure of cells to increasing concentrations of doxorubicin and wasmaintained in the presence of 0.5 lm doxorubicin. A total of 2008 parental cells and their ... that MRP1 interferes with the accu-mulation of rhodamines and drugs participating in theMDR phenomenon inside a wide variety of healthy and malignant cells. Presumably, drugs exhibiting a high ... oilcushion and dissolved prior to determination of theamount of dyes associated with them. The advantages of such an assay are that: (a) it is quantitative; (b) it isnot affected by intracellular quenching...
- 12
- 651
- 0
Báo cáo khoa học: Human telomeric G-quadruplex: thermodynamic and kinetic studies of telomeric quadruplex stability potx
... quadruplex folding and unfolding reac-tions, with the significant advantage that enthalpychanges can be monitored directly and data obtained in a model-free fashion [36,37]. Disadvantages of ... spectra as a function of temperature,instead of single wavelength data. A set of spectra as a function of temperature defines a 3D surface that iseasily converted to a matrix. Singular value ... italics.No intermediate states are shown alongeach pathway, only the initial and finalstates. Guanine bases are shown in green,adenines in red and thymines in blue.J. B. Chaires Telomeric quadruplex...
- 9
- 370
- 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 °C; 1 min/56 °C; 4 min/72 °CAAACTCGAGTTATTATTCAATATCAAACAGAG59/750 AAAAGATCTAAAGCATTTTTGGATGAATTG 1 min/94 °C; 1 min/54 °C; 4 min/72 °CATTCTCGAGTCATTAGGCTACTTCACTCAAAG90/750 ... min/57 °C; 4 min/72 °CATTCTCGAGTCATTAGGCTACTTCACTCAAAG274/587 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 °C; 1 min/56 °C; 3 min/72 °CCACCTCGAGTTATTATAGCTCAAACACCATCC44/587 AAACTCGAGAGATCTAAATCCTCCAATGAAGC ... °CATTCTCGAGTCATTAGGCTACTTCACTCAAAG90/750 AAAAGATCTTTTCAGCTTGCAAAGCAA 1 min/94 °C; 1 min/57 °C; 4 min/72 °CATTCTCGAGTCATTAGGCTACTTCACTCAAAG122/750 AAAAGATCTAAGACTCATCCCAACTAC 1 min/94 °C; 1 min/54 °C; 4 min/72...
- 9
- 414
- 0
Báo cáo khoa học: Residues affecting the chloride regulation and substrate selectivity of the angiotensin-converting enzymes (ACE and ACE2) identified by site-directed mutagenesis pot
... result of an alteration in substrate-binding affinity but of anincrease in Vmax. The R514Q ACE2 variant or variants with enhanced activity towards angiotensin II havepotential therapeutic value in ... bars) NaCl. (A) Cleavage of angiotensin I by tACE variants. (B)Cleavage of angiotensin I by ACE2 variants. (C) Cleavage of angio-tensin II by ACE2 variants. Generation of product was determinedby ... [27], increasesangiotensin I and decreases angiotensin II cleavage byACE2 and increases angiotensin I cleavage by ACE.This would have the effect of increasing the localizedconcentration of the...
- 10
- 362
- 1
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
... reducing agent and incubated at 33 °Cfor30mintoloadanSDS/polyacrylamidegel.TheSDS/PAGE analysis detected three proteins bands by CBBstaining and one activity band by activity staining. Proteinsincluding ... SDS/PAGE.N-Terminal amino-acid sequencing analysis indicated thatthematureproteinofP. hilaris cellulase was a truncatedform, which lacked a signal peptide composed of the first 21amino acids. ... isolation of mRNA from P. hilarislarval midguts. First-strand cDNA synthesis from theisolated mRNA and the following amplification of thetarget cDNA were performed with a SMARTTMRACEcDNA Amplification...
- 6
- 361
- 0
Báo cáo khoa học: Structural insight into the evolutionary and pharmacologic homology of glutamate carboxypeptidases II and III ppt
... ‘pseudo-unliganded’ complexonly), as having either favorable or allowed conforma-tions. Despite falling into the disallowed region of theRamachandran plot, all atoms of Lys197 and Asn168have a well ... (aminoacids 46–106 and 342–580), an apical domain (aminoacids 107–341) and a helical domain (amino acids 581–740). The overall structures of both proteins are quitesimilar, with rmsd values ... eleven a- helices. The apicaldomain (or the protease associated domain) is insertedinto the protease domain and features a (3 + 4)-stranded b-sandwich flanked by four a- helices. Theprincipal motif...
- 15
- 355
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ