Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

... 4760-4783SP10R CATGCCAGACCCTGATATTATCACC 5468-549211 SP11F ACCTACACCAATGTCACCTGGAC 5328-5350SP11R GTGCCACACCTACTATGACCACAG 5890-591312 SP12F TCAAGCCTCCAAACCAAGCC 5784-5803SP12R TGGCGGTCCATAAATGAGGTG ... SP8F CCTTCTACAACACCAAATGATTGCC 3768-3792SP8R AGGCCAGGATGTCAACACTGGCAC 4371-43949 SP9F ATGTATGGATAGCCCTCAGATTG 4261-4283SP9R GTCCACATCAACGGCCGCCGGCTCG 4890-491410 SP10F AGCCAACAGACACTCCTGTGTTCC ... CentralPage 1 of 10(page number not for citation purposes)Virology JournalOpen AccessResearch Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus...

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... C-terminal sequence of the coding region: 5¢TTACAAGGACAAATTAATTGTGCCAG. For amplification of the long isoform the same 5¢ primers were used, the 3¢specific primer was FF3B: 5¢TTACAAGTCTTGCAAAGGGAAGGAT. ... molecular mass protein allergens intomato extract (not shown).Peptide map and glycan analysis of the naturalb-fructofuranosidaseInvestigation of the carbohydrate moieties of the purifiedallergen ... 2003 Molecular characterization and allergenic activity of Lyc e 2(b-fructofuranosidase), a glycosylated allergen of tomatoSandra Westphal1, Daniel Kolarich2, Kay Foetisch1, Iris Lauer1,...

Báo cáo khoa học: Molecular characterization and gene disruption of mouse lysosomal putative serine carboxypeptidase 1 ppt

... intermediate of 28 kDa (lane 4). PNGase F treatment of the 18 kDa subunit resulted in a partial shift towards a lower molecular mass of  16 kDa (lane 4). Consider-ing an apparent molecular mass of about ... using the Scpep1 antiserum to detect the 35 kDa fragment and an anti-Ctsa rat IgG2B to detect the 32 kDa heavy chain of Ctsa.K. Kollmann et al. Functional characterization of lysosomal Scpep1FEBS ... a- cathepsin D rabbit antiserum [35], a- Lamp1 ratIgG 2A (1D4B, Developmental Studies Hybridoma Bank,Iowa City, IA, USA) and a- Scpep1 antisera derived from rabbit and rat. Horseradish peroxidase- and ﬂuorescence-conjugated...

Báo cáo khoa học: "Molecular characterization and genogrouping of VP1 of aquatic birnavirus GC1 isolated from rockfish Sebastes schlegeli in Korea" potx

... lengthGVP1.1FGVP1.1RGVP1.2FGVP1.2RGVP1.3FGVP1.3RGVP1.4FGVP1.4RGVP1.5FGVP1.5RGVP1.6FGVP1.6RGVP1.7FGVP1.7RGGAAACAGTGGGTCAACGTTAGAAGTGTGATGTCCGGAGCCCATTCCACAAGCCAGACCAAGGAGTCAGCCAGTACGAGCTCCTCAGCCGGCCTACCATAGAGTACCATGTGTTGTCCTGAAGAGACAGCCTGGACAATGGTCTCGACGGCCTCAACGATAAGATAGAGCGCGAGCTGAAATTCCTTCTAGGTCTCCTCCCAAGAGGAAGAGACTGGAAGTGTTGTGCCAGTTCCTCAGTTACGAGATCAAGCACTAGCGTCCCTGGCGGAACCGGATGT ... H1, AY98, and Y6 from Japan. Geno-group 1 mostly consisted of strains from the Pacific coastal nations; DRT is from Korea, WB from the USA, Jasper from Canada, and AM98 from Japan. The isolates ... many polymerases. Nucleic Acids Res 1988, 16, 9909-9916.2. Azad AA, Barrett SA, Fahey KJ. The characterization and molecular cloning of the double-stranded RNA genome of an Australian strain...

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... TGATGATTTGGAACCATTATTGAAIL-10 reverse3 CACCTTTTTCCTTCATCTTTTCATb-Actin forward1 ACTACCTCATGAAGATCCTGb-Actin reverse1 TTGCTGATCCACATCTGCTGT7- forward TAATACGACTCACTATAGGGSP6-reverse ATTTAGGTGACACTATAGAAFig. 1. Genomic ... 4653Cloning, characterization and expression analysis of interleukin-10 from the common carp,Cyprinus carpioL.Ram Savan1, Daisuke Igawa2 and Masahiro Sakai21United Graduate School of Agricultural ... conservedregions, and ampliﬁed product gave a speciﬁc product of 284 bp. A set of b-actin primers (forward:5¢-ACTACCTCATGAAGATCCTG-3¢ and reverse:5¢-TTGCTGACCACATCTGCTG-3¢) served as a controlfor the quantity...

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R,5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GT-cDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTACCTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTTCCAAGTGC-3¢ for GT-cDNA2 (3043 bp).Construction and ... A, 5¢-TGTCAGTCCTGTACAAAGAC-3¢ and Primer B, 5¢-CATCAGGCTTCCCCATA-3¢. Gene-speciﬁc nested primersfor 3¢-RACE were: Primer C, 5¢-CCAGTGTCCCCATCATCAG-3¢ and Primer D, 5¢-GGCAATTTTAAAGTCATTATGGCGCAAA-3¢. ... consists of 12 exons and 11 introns, and anopen reading frame (ORF) of 1599 bp encoding a poly-peptide of 533 amino acids, with a predicted molecular mass of  57 kDa and a pI of 8.34.BLASTXanalysis...

Báo cáo khoa học: "Elevated troponin and myocardial infarction in the intensive care unit: a prospective study" potx

... Institutes of Health Research, DJC is a Research Chair of the Canadian Institutes for Health Research, MAC holds a Career Investigator Award from the Heart and Stroke Foundation of Canada, and PJD ... Regional Medical Associates of McMaster University, Canada, and the Father Sean O'Sullivan Research Center of St. Joseph's Hospital in Hamilton. We thank Andrea Tkaczyk, Laura Donahoe, ... meta -analysis of randomized trials of antiplatelet therapy for prevention of death, myocardial infarction, and stroke in high-risk patients.BMJ 2002, 324:71-86.29. Assessment of the Safety and...

Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebraﬁsh (Danio rerio) doc

... running from midbrain tohindbrain along the bilateral symmetry axis. The labe-led specialized large and elongated cells of the anter-ior part of the ﬂoor-plate were positioned at the base of the ... cranial ganglia including the trigeminalganglia and their projections (Fig. 4A, B,D,E). The hybridization signal was maintained in the ganglia upto the larval stages (Fig. 4G–J,L) while an additionalprp1 ... separating the two lobes of the mesencephalic tegmentum and above the hypothala-mus (Fig. 4A E). Situated at the ventral-most part of the neural tube, the ﬂoor-plate is a specialized glialstructure...

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding speciﬁcity and target candidates doc

... 5¢-GAGCCAACAGAAGTTTGCTTCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAACTTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATGCAGAAATTCAGTAGCAACATGGTGGAACGATGTCTCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCACCATGTTGCTACTGAATTTCTGCA-3¢ ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 (1) Protein containing DNAJ domain;unknown functioncuacgucggacggaacugggaaaccgaucaguguugguagugaguuaacucggugaccgaguuaguagaacgaguuaauuagUGUAAAUAcgaagccaAt4g39090 ... containing PHD domain;unknown functionugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaatAGUAAAUAaauaacgacaagaagcaaauggAt5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040...

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulﬁde isomerase family proteins with nonclassic active center motifs pdf

... 5¢-GACGACGACAAGATGGAGGTTAAGGATGAGTTG-3¢ and 5¢-GAGGAGAAGCCCGGTCTATAACTCATCTTTGAGTAC-3¢for GmPDIL- 3a, and 5¢ -GACGACGACAAGATGGAGGTTGAGGATGAGTTGG-3¢ and 5¢-GAGGAGAAGCCCGGTTCATAACTCATCTTTGACGAC-3¢ ... with a Thermal Cycler Dice RealTime System (TaKaRa Bio Inc.). Forward primers 5¢-CGTTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CACAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi-trogen Corporation) and reverse ... 77–99.16 Kamauchi S, Wadahama H, Iwasaki K, Nakamoto Y,Nishizawa K, Ishimoto M, Kawada T & Urade R (2008) Molecular cloning and characterization of two soybeanprotein disulﬁde isomerases as molecular...

Xem thêm