báo cáo khoa học: " Identification of flowering genes in strawberry, a perennial SD plant" potx

... AGAGCTTTCCTCTGGGAGAGAAP1 CGCTCCAGAAGAAGGATAAGG CATGTGACTGAGCCTGTGCTAP1 TCTGAAGCACGTAAGGTCTA ATCCTGATCATAACCTCCAGLHY AAAGCTGGAGAAGGAGGCAGTC CCGAGGATAAGGATTGCTTGGTZTL TGCATGGGGTAGTGAAACAA CACCTCCGACAGTGACCTTTFKF1 ... CCTCACAATCATCCACCAATCC CGCCGATGTTGATCACCAAGA2ox CACCATGCCCAGAGCTTCA AGGCCAGAGGTGTTGTTGGATTFL1 TGCAGAAACAAACGAGTTCGG CCAAGAGCATCGATCATTTGGTAP2 CCCGAAATCCTTGATTGTTCC AACACTGCAATCGAACAACAGCTmvalue ... GGAGAGCCAGAACCAGGAG CTCACCTTCTTCCCCTTCCTFVE GATCCAGCAGCAACCAAGTCTC CCTCTTGGTGCAACAGAAGGACSVP CGTGCTAAGGCAGATGAATGG TGAAGCACACGGTCAAGACTTCSPY TGCGGTGTCAAATTGCATCA GGCAACACTCAAGATGGATTGCGA3ox...

báo cáo khoa học: " Identification of imprinted genes subject to parent-of-origin specific expression in Arabidopsis thaliana seeds" potx

... Relative quantification of maternal and paternal trans cripts for ATCDC48 in Arabidopsis thaliana F1 hybrid seeds (4 dap).Transcript expression levels of maternal and paternal alleles of ATCDC48 ... proteinAt1g16730 Unknown proteinAt1g17840 ABC transporter family proteinAt1g31820 Amino acid permease family proteinAt1g54710 AtATG18At1g55320 Ligase, similar to acyl-activating enzyme 17 (AAE17)At1g61990 ... Ubiquitin family proteinAt4g16830 Nuclear RNA-binding protein (RGGA)At4g21270 AT KINESIN 1At4g29450 Leucine-rich repeat protein kinase, putativeAt4g33450 Myb domain protein 69 (AtMYB69)At4g37530...

Báo cáo khoa học: "Identification of Acanthocephala discovered in changran-pickles and myungran-pickles" docx

... gadi.References1.Arai, H. P. Acanthocephala. In Guide to the parasites of fishes of Canada. Prat III, L. Margolis and Z. Kabata (eds.).Canadian Special Publication of Fisheries and AquiticSciences ... the length, and width of the body and internal organs were measured. Species identification was made according to Van Cleave [9] andYamaguti [11] classification of the acanthocephala.ResultsMorphology ... of body. Table 2 shows the measurements of each femaleorgan E gadi.Discussion In the classification of acanthocephala by Van Cleave [9]and Yamaguti [11], the body of Echinorhynchus was smallor...

Báo cáo y học: " Identification of fusion genes in breast cancer by paired-end RNA-sequencing" potx

... Chen G, Cao Q, Han B, Dhanasekaran SM, Ponnala R,Cao X, Varambally S, Thomas DG, Giordano TJ, Beer DG, Palanisamy N,Sartor MA, Omenn GS, Chinnaiyan AM: An integrative approach to revealdriver ... ligation,SLX_PE_Adapter1_ds 5’[Phos]GATCGGAAGAGCGGT-TCAGCAGGAATGCCGA*G, SLX_PE_Adapter1_us5 A* CACTCTTTCCCTACACGACGCTCTTCCGATCT;PCR library, SLX_P E_PCR_Primer1f 5’ A* ATGA-TACGGCGA CCACCGAGATCTACACTCTTTCCCTA-CACGACGCTCTTCCGATC*T, ... Nature 2010, 465:473-477.19. Palanisamy N, Ateeq B, Kalyana-Sundaram S, Pflueger D, Ramnarayanan K,Shankar S, Han B, Cao Q, Cao X, Suleman K, Kumar-Sinha C,Dhanasekaran SM, Chen YB, Esgueva...

Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf

... consists of an inner linear region of Araf-(1 fi 5) -a- Araf and of branched non-reducing terminal Ara6 motifs: Arafb1fi 2Arafa1 fi 5 (A rafb1 fi 2Arafa1 fi 3)Arafa1 fi5Arafa1. About two-thirds of the terminal ... pep-tidoglycan, d-arabinofuranose (Araf)-containing arabi-nogalactan and arabinomannan polysaccharides,mannans, glucans, long-chain (C70–C90) a- branched,b-hydroxy fatty acids (mycolic acids) and ... and(lipo)arabinomannan polymers of the cell wall and of some glycerol-based glycolipids [26]. The branchedarabinan chains of the arabinogalactan are attached tothe linear galactan backbone. The arabinan...

Báo cáo khoa học: "characterization of phosphorus fractions in natural and fertilized forest soils" potx

... that anincrease of the rainfall causes a decrease of the quality of SOM as a consequence of decreasing the pH and increas-ing of free Al. Then, at least two factors, MAP and SOMquality affecting ... superphosphate at100 kg P ha–1 in April 1992. Some climatic and edaphicdata are given in tables I and II. The climate of the area is characterized by rainyautumn and spring, and hot, dry ... Mar a- Isabel Gonzálezc, Wolfgang Zechd a University of Valladolid, E.T.S.I .A. , Area de Edafolog a y Química Agrícola, 34004 Palencia, Spainb C.S.I.C., Aptdo. 257, 37071 Salamanca, Spainc...

báo cáo khoa học: " Identification of differentially expressed genes induced by Bamboo mosaic virus infection in Nicotiana benthamiana by cDNA-amplified fragment length polymorphism" pps

... ACCT8-1, ACCT2-1, and ACCT13.The forward primers are (5 ’GA ACAAAAAAATG-GAGTTTTA3’), (5’CGAACTCCCAACTGGCTTTC3’ ),(5’CTCTG GAAAGGAGAGCAATGTC3’), and (5’GAACGCTTTGATGAGAATAGAGA3’) and the reverse ... pairs for ACAG1 (forward, 5’GAGAAAAT-GAAGGAGAAGGCCC3’ ; reverse, 5’ GCT CTGCCTTCTTCAATTGCTTCTT3’ ) and AC AG8 (forward,5’GAAGGAAGCTGTGAATGTGTCA3’; reverse, 5’TGGTTAAGTTCATACGGAAAGA3’) were ... protein, indicating a positive influenceon the accumulation of BaMV in plants. An interesting observation was that eight of the nine plants showing anincrease in BaMV coat protein were associated...

báo cáo khoa học: " Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" doc

... electrophoresis.RLM-5’ RACETotal RNA (200 μg) from soybean seeds was used topurify mRNA using the Oligotex kit (Qiagen). 5’ RNAadaptor (5’ -CGACUGGAGCACGAGGACACUGA-CAUGGACUGAAGGAGUAGAAA-3’ ) was ligated tothe ... SBSsequencing.The small RNA library and degradome library sequen-cing data were available under NCBI-GEO accession no.GSE25260.Bioinformatic analysis of sequencing dataSmall RNA reads and degradome ... SJ, Janardhanan P,Kannan V, Rymarquis LA, Nobuta Kan, German R, Paoli ED, Lu C, Schroth G,Meyers BC, Green PJ: Global identification of microRNA-target RNA pairsbyparallel analysis of RNA ends....

báo cáo khoa học: " Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms" potx

... Imai A, Matsuyama T, Hanzawa Y, Akiyama T, Tamaoki M, Saji H, Shirano Y,Kato T, Hayashi H, Shibata D, Tabata S, Komeda Y, Takahashi T: Spermidinesynthase genes are essential for survival of Arabidopsis. ... resulting in an approximately seven-fold increase in the total amino acid content. Theexpression of the AS gene, encoding a transaminaseresponsible for the synthesis of asparagine from aspar-tate ... stress (data not shown).Asparagine and phenylalanine levels increased greatlyafter 15 days of water stress in both youn g and matureculm internodes. The most abundant amino acid afterwater deficit...

báo cáo khoa học: " Identification of rhizome-specific genes by genome-wide differential expression Analysis in Oryza longistaminata" doc

... jasmonate-mediated activation of the PDF1.2 gene of Arabidopsis. Plant Physiol 2003, 132:1020-1032.46. Maruyama-Nakashita A, Nakamura Y, Watanabe-Takahashi A, Inoue E,Yamaya T, Takahashi H: Identification of ... ASYMMETRIC LEAVES2gene of Arabidopsis thaliana, required for formation of a symmetric flatleaf lamina, encodes a member of a novel family of proteinscharacterized by cysteine repeats and a leucine ... M, Fujioka T, Kaneko F, Kazama T, Mizuta Y, Takahashi H,Shiono K, Nakazono M, Tsutsumi N, Nagamura Y, Kurata N, Watanabe M,Matsuoka M: Various spatiotemporal expression profiles of anther-expressed...

Xem thêm