Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc
Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc
... with the real-time PCR assay
and in only 11 samples with a conventional PCR assay. The real-time assay using the TaqMan-system can therefore
be practically used for studying the epidemiology and ... NS1 gene. The
results of the real-time PCR assays were compared with
those of previously established, conventional PCR assays.
Materials and metho...
Báo cáo y học: "Detection of bone erosions in rheumatoid arthritis wrist joints with magnetic resonance imaging, computed tomography and radiography" ppt
... the
metacarpophalangeal joints, and many of the small carpal
bones have irregular margins with indentations (for example, at
the attachment of ligaments), making discrimination between
normal anatomy and presence ... duration 7 years (range 4–22 years)), and three con-
trol individuals were female and one was male (median age 36
years (range 34–57 years)). All individuals...
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "
... Medicine,
Animal Care and Use Committee. The rats were cared
for in accordance with the Guide for the Care and Use of
Laboratory Animals.
Statistical analysis
The results were recorded by the principal ... control and air leaks when the
authors performed recurrent thoracotomy for any
reason, and confirmed the efficacy of TachoSil® as an
anti-adhesive ag...
Báo cáo y học: " Impact of concomitant DMARD therapy on adherence to treatment with etanercept and infliximab in rheumatoid arthritis. Results from a six-year observational study in southern Sweden" docx
... approximately 2% of the with-
drawal cases, the cause of cessation was registered as both
treatment failure and AE; for these patients, the cause of with-
drawal was subsequently classified as an AE. Patients ... activity when comparing infliximab with
etanercept, and bias in the withdrawal of patients because of
treatment failure is therefore unlikely. Finally,...
Báo cáo y học: "Bonding of articular cartilage using a combination of biochemical degradation and surface cross-linking" pdf
... out the
bonding experiments and the cytotoxicity assay. JB carried out
the analysis of the extracellular matrix content. JF carried out
the analysis of the relaxation behaviour and participated ... determined for all
substances employed, that is, surface degrading agents and
cross-linkers, using the resazurin assay. Taking the favourable
cell vitality after treat...
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt
... In
Table 1
Basic clinical data, details of arthropathy, serologic findings, and therapy
Case Age/gender Clinical presentation
and arthropathy
Spleen, mm ANA RF IgM, IU/mL ANCA CCP aCL HP Therapy
1 84/F ... Hanna Makuch-Łasica
4
,
Mirosław Majewski
4
, Katarzyna Michalak
5
, Robert Rupiński
6
, Krzysztof Warzocha
7
and
Renata Maryniak
1
1
Department of Pathomorphology, Institute...
Báo cáo y học: " Detection of HIV-1 RNA/DNA and CD4 mRNA in feces and urine from chronic HIV-1 infected subjects with and without anti-retroviral therapy" pptx
... are very complex
and so far no sensitive methods are available for detection
of viral and human RNA/DNA in human feces, we have
initially tested assay sensitivity for nucleic acid isolation
and ... subjects with and without
anti-retroviral therapy
Ayan K Chakrabarti, Lori Caruso, Ming Ding, Chengli Shen,
William Buchanan, Phalguni Gupta, Charles R Rinaldo and Yue Chen*
A...
Báo cáo y học: " Detection of dengue-4 virus in pune, western india after an absence of 30 years - its association with two severe cases" docx
... consisting of viruses from Southeast Asia
(genotype I), Southeast Asia and the Americas (genotype
II), Thailand (genotype III) and Malaysia (Sylvatic) [10].
The 2009 isolate belonged to genotype I or the ... of
theseasoninJune2010.Thetwocaseswerehospita-
lised patients and underwent standard daily cl inical eva-
luation and physical examinations. The case history
forms of...
Báo cáo y học: "Prevalence of porcine circovirus-like agent P1 in Jiangsu, China" docx
... pmol of forward primer F3 and reverse primer R3, 2.5 mM
dNTPs and 0.75U DNA Polymerase. The amplification was performed using a PCR thermal
cycler (TaKaRa) and was initiated by heating for 5 ... genome containing overlapping regions to verify.
F3: 5-TTAAAGACCCCCCACTTAAACCCTAAATGA-3′, and R3 :5′ -
AGTGGGGGGTCTTTAAGATTAAATTCTCTG-3′. (Figure 1).
Figure 1 Schematic diagram...
Báo cáo y học: " Detection of swine transmissible gastroenteritis coronavirus using loop-mediated isothermal amplification" pptx
... CCATCTTCCTTTGAAGTCCA
TGEV-FIP Forward
Inner
45 CGAGGTCACTGTCACCAAAATT
TGATGTGACAAGATTTTATGGAG
TGEV-BIP Reverse
Inner
42 GGAGCAGTGCCAAGCATTAC
AAAATGCTAGACACAGATGGAA
TGEV-LF Forward
Loop
17 GGCTGAACTGCTTCTAG
TGEV-LB ... Fragment; New England Biolabs,
USA) with 2 μL total RNA as template. The amplifica-
tion was performed at 60°C in a laboratory water bath
(Kangle, China, 25°C~99°C, with...
Từ khóa:
- báo cáo y học
- báo cáo y học cổ truyền
- mẫu báo cáo y học cổ truyền
- báo cáo khoa học y học
- báo cáo y tế học đường
- mẫu báo cáo y tế học đường
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- chuyên đề điện xoay chiều theo dạng
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát hiện xâm nhập dựa trên thuật toán k means
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Chuong 2 nhận dạng rui ro
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- chuong 1 tong quan quan tri rui ro
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật