0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx

báo cáo khoa học:

báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx

... is able to affect the bone healing process; 2. The comparison of test and control groups indicatesthat bone healing was accelerated by the effect of mag-netic fields in all the conditions analyzed;3. ... predominantly hori-zontal and flat direction maintained continuity and shape of the remaining cortical levels. Trabecular proliferationwas also apparent in a centripetal direction relative to the surgical ... the writing of all iterations of the paper, including the finalversion of the manuscript. JJCF participated in the analysis of results and implementation of material and other con-ditions for development...
  • 9
  • 361
  • 0
Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot

Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot

... upregulation of a number of Golgi proteins in Golgi preparations from rat mammary gland cells in the state of maximal secretion at lactation as compared to that in a state of basal secretion. This ... the maturation of the organelle was monitored by comparative analysis of phagosomes in different stages. The authors demonstratedthat the phagosomes acquire cathepsins, key catabolicenzymes of ... there are findings on known proteinsthat confirm literature data. Secondly, there are findings on known proteins that are not covered by the literature, butthat are additionally validated in the...
  • 11
  • 493
  • 0
báo cáo khoa học:

báo cáo khoa học: " Pilot study evaluating the effects of an intervention to enhance culturally appropriate hypertension education among healthcare providers in a primary care setting" pdf

... because almost all of them had completed a some-what similar training, organised by the PCHCs at an ear-lier stage. After the training, the tools for CAHE weremade available on paper to the healthcare ... between the interven-tion and control groups.Table 4 shows the mean scores of the respondents of the intervention and control groups and the results of the ANOVA analysis on each of the four scales ... authors read and approved the final manuscript.Table 4: Comparison of the intervention and control groups at T0 and at T1One-way ANOVA for the four scalesIntervention ControlMean (SD) Mean (SD)...
  • 10
  • 440
  • 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

... of immunoreactivity in the latter strain was due to the inability of the truncated protein to insert into and be stable in the inner mitochondrial membrane or lack of detection of the truncated protein ... 1211Interestingly, the absence of subunit 6 also resulted in anincrease in the ratio of intermediate to mature cyto-chrome c1and a disappearance of the intermediate form of the Rieske protein. ... protein 1 and core protein 2 in the mito-chondrial membranes of all of the deletion mutants suggestthat these can be assembled as a subcomplex in the mito-chondrial membrane, independent of the...
  • 10
  • 517
  • 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA 5′3′UAAAUGUGAAUACUAAGAGUAAGCAAUGUGAUAIL6R mRNA mut 1 ... in about252 1A BC 5′3′ 5′ 3′ 5′ 5′3′3′UAUAAGAGUAUCCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ ... 0.05).25215′3′5′3′5′3′5′CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA3′UAAAUGUGAAUACAAUGUGAAAGCAAUGUGAUAIL6R mRNAmiR-2 3a 253120 A B18161412**10EGFP intensity86420EGFPEGFP-IL6R...
  • 9
  • 541
  • 0
Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

... relevant to the regulation of AC proteins. In view of the important and antagonistic effects of ADF ⁄ cofilin and phosphate on actin dynamics, weexamined here the binding of cofilin to F-actin and ... of subdomain 2, while phosphate has a stabilizing effect on F-actin structure. The antagonistic effects of Pi andAC proteins on F-actin are also indicated by increaseddissociation of Pi from actin ... polymerization of F-actin is low.F-ADP-actin can also be polymerized from ADP–G-actin in the absence of ATP. In this case all the proto-mers contain ADP and there is no cap at the barbedend. ADP–F-actin...
  • 9
  • 487
  • 0
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

... adaptations in the eye in the human lineage. In addition to the evolution of cN and cS crystal-lins, even more specialization in the c-crystallins hasoccurred with the loss of the N-terminal ... USA).All use of animals complied with the ARVO Statementfor the Use of Animals in Ophthalmic and Vision Researchand the Intramural Animal Care and Use program of the National Institutes of Health (NIH).G. ... during mam-malian evolution. These changes illustrate the way in which gene families may expand, contract and adapt.They may also help us understand the functions of the c-crystallin family in...
  • 16
  • 561
  • 0
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

... geneexpression was absent in cells with a functional inactive HIFor lacking the HIF- 1a protein in general. In fact, for the P4ha1I the involvement of HIF in the activation of geneexpression during ... revealed a characteristic time-dependent increase of the mRNA abun-dance in A7 r5 cells incubated at 1% oxygen for P4ha1 andP4ha2, starting around 4 h of hypoxia, the induction of P4ha2 mRNA being ... procollagen Ia mRNA remainedunchanged after 12 h of stimulation (Fig. 5A) . The stimu-latory effect of hypoxia and of deferoxamine on P4ha1 andP4ha2 mRNA and PDI mRNA was almost abrogated in Hepa1C4...
  • 8
  • 434
  • 0
Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx

Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx

... chelatorssuggesting that the chelators may act intracellularly as well asat the cell membrane. In conclusion (a) rat hepatocytes have a much greater capacity to take up NTBI than the rat hep-atoma cell line ... anabnormally high absorption of Fe leading to saturation of the plasma Tf. Patients with the hereditary anemiathalassemia [4,5] also have increased plasma Fe, primarilydue to the obligatory treatment ... multidentate pyridinoneshave potential in the treatment of Fe overload, particularly atlower, more readily clinically available concentrations, andduring cancer chemotherapy, by removing plasma NTBI.Keywords:...
  • 10
  • 545
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Detecting Novel Compounds: The Role of Distributional Evidence" potx

... 1997. Integrating sym-bolic and statistical representations: The lexicon pragmat-ics interface. In Proceedings of the 35th Annual Meeting of the Association for Computational Linguistics and ... Natural Language Processing. The MIT Press, Cambridge, MA.Elaine Marsh. 1984. A computational analysis of complexnoun phrases in navy messages. In Proceedings of the 10th International Conference ... that Roget's thesaurus is too coarse-grained a taxonomy for the task at hand (Ro-get's taxonomy contains 1,043 concepts, whereasWordNet contains 4,795).We further examined the accuracy...
  • 8
  • 583
  • 0

Xem thêm

Từ khóa: báo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pottài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ