Báo cáo y học: " Dissemination of Strongyloides stercoralis in a patient with systemic lupus erythematosus after initiation of albendazole: a case report" docx
Báo cáo y học: " Dissemination of Strongyloides stercoralis in a patient with systemic lupus erythematosus after initiation of albendazole: a case report" docx
... improvement after institution of ivermectin. Case presentation A 38-year-old woman emigrated from the DominicanRepublic 1 year prior to presentation with complaints of 6days of abdominal pain and blood-flecked ... andEscherichia coli. After 10 days of ivermectin and consistently negative stoolexamination for ova and parasites, antiparasitic therapywas discontinued. The patient was continued on appropri-ate antibiotics ... completion of therapy.This case is unusual because disseminated diseaseoccurred 3 days after initiation of therapy with albenda-zole. We are uncertain why dissemination occurred in thistime...
- 3
- 277
- 0
Báo cáo y học: "CD147 overexpression on synoviocytes in rheumatoid arthritis enhances matrix metalloproteinase production and invasiveness of synoviocytes" pptx
... 5'-ACATCAACGAGGGGGAGACG-3'and 5'-GGCTTCAGACAGGCAGGACA-3' for CD147 (492bp); and 5'-CTGAACGGGAAGCT CACTGG-3' and 5'-TGAGGTCCACCACCCTGTTG-3' for glyceraldehyde ... the lining and sublininglayers of RA synovium, and macrophages acted as the ampli-fier of the pathogenetic cascade in RA via the increase of MMP production by interacting macrophages with fibroblasts[10]. ... hepatoma-associated antigen cloned by hepatoma mono-clonal antibody HAb18 from a human hepatocellular carci-noma cDNA library. HAb18G is a highly glycosylatedtransmembrane protein of 60 kDa with an ectodomain...
- 12
- 339
- 0
Báo cáo y học: "Leukocyte numbers and function in subjects eating n-3 enriched foods: selective depression of natural killer cell levels" potx
... University of South Australia, Australia, Adelaide SA 5000, Australia4Discipline of Paediatrics, University of Adelaide, 72 King William Road, North Adelaide SA 5006, AustraliaCorresponding author: ... treatment of autoimmuneand allergic inflammatory conditions [1-4]. Counterbalancingn-6 fatty-acid intake with n-3 fatty acids is important becausen-6 fatty acids, such as arachidonic acid (AA) ... enzyme-linked immunosorbent assay [18].Statistical analysisAll statistical analyses were performed using GraphPad InStatsoftware. Data were analyzed as comparisons between pla-cebo and n-3 PUFA-supplemented...
- 11
- 469
- 0
Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx
... Tanaka Y, Marusawa H, Seno H, Matsumoto Y, Ueda Y, Kodama Y, Endo Y, Yamauchi J, Matsumoto T, Takaori-Kondo A, et al.: Anti-viral protein APOBEC3G is induced by interferon-alphastimulation in ... HIV-1propagation was seen only at an early time point follow-ing initiation of the co-culture (i.e. 2 days) and was rap-idly lost thereafter is indicative of a modulatory effect onintricate interactions ... infections can damage the epithelialbarrier and cause microbial translocation leading ulti-mately to inflammation and activation of mDCs and mac-rophages. In steady-state, resident flora of...
- 16
- 288
- 0
Báo cáo y học: "Culture-negative bivalvular endocarditis with myocardial destruction in a patient with systemic lupus erythematosus: a case report." ppsx
... vena cava, dome of the l eft atrium,right atrium, and intra-atrial septum.Valve tissue was sent for pathology and microbiologicanalysis. The patient was started on vancomycin andciprofloxacin. ... participated in the care of the patient and wrote the initial manuscript.BS participated in the care of the patient and edited the manuscript. Allauthors participated in approving the final ... AccessCulture-negative bivalvular endocarditis with myocardial destruction in a patient with systemic lupus erythematosus: a case reportBrett R Laurence*and Byungse SuhAbstractCulture-negative endocarditis...
- 4
- 221
- 0
Báo cáo y học: "Traumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracture" pptx
... T, Karampelas Ioannis, Karydas Georgios, Karabinis Andreas:Unilateral and bilateral vertebral artery dissection followingmotor vehicle injury – two cases and a mini-review. Interna-tional Journal ... purposes)Journal of Brachial Plexus and Peripheral Nerve InjuryOpen Access Case reportTraumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracturesSilas ... that the accuracy of CTA in vertebral injury remains in question. It was Alex-ander L. Eastman et al. [12] in a large series of 162 patient who demonstrated that CTA is a very good screening toolfor...
- 4
- 371
- 0
Báo cáo y học: " Gene promoter methylation assayed in exhaled breath, with differences in smokers and lung cancer patients" ppt
... bp(-240~+50)PAX5β-TFPAX5β-TRCGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC301 bp(-92~+141)Quantitative MSP primersDAPK-qFDAPK-qRAG(C/T)G(C/T)GGAGTTGGGAGGAGTACAAAC (A/ G)ACCAATAAAAACCCTACAAAC121 ... PrimerRASSF 1A- TFRASSF 1A- TRCGACTCCTGCACTCATTAACCCTCACTAAAGAGGGT(T/C)GGATGTGGGGATTTGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCCCAAAATCCAAACTAAAC337 bp(-254~+39)DAPK-TFDAPK-TRCGACTCCTGCACTCATTAACCCTCACTAAAGTGGGTGTGGGG(T/C)GAGTGGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTCC (A/ G)C (A/ G)AAAAAAACAAAATC358 ... bp(-254~+39)DAPK-TFDAPK-TRCGACTCCTGCACTCATTAACCCTCACTAAAGTGGGTGTGGGG(T/C)GAGTGGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTCC (A/ G)C (A/ G)AAAAAAACAAAATC358 bp(-240~+50)PAX5β-TFPAX5β-TRCGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC301...
- 12
- 383
- 0
Báo cáo y học: " Medroxyprogesterone improves nocturnal breathing in postmenopausal women with chronic obstructive pulmonary disease" pps
... Althoughthe maximum inspiratory slope was already at baselinewithin normal postmenopausal range, MPA almost dou-bled the slope. This finding is in line with the thinkingthat the baseline respiratory ... recordings, par-ticipated in the analyses and interpretation of data, anddrafted the manuscript.TA constructed the analysis model for tcCO2 signal, partic-ipated in the analyses and interpretation ... and interpretation of tcCO2 dataand in the statistical analyses, and drafted the manuscript.KU participated in the analyses and interpretation of tcCO2 data, and drafted the manuscript.OP...
- 12
- 293
- 0
Báo cáo y học: "Impaired urge-to-cough in elderly patients with aspiration pneumonia" doc
... takae_montreal@hotmail.com; Miyako Yamasaki - ymskmyk@idac.tohoku.ac.jp; Takaaki Asamura - t-asamuraum777@silk.plala.or.jp; Masanori Asada - m-asada@idac.tohoku.ac.jp; Kaori Une - unekaori@hotmail.com; Hiroyuki Arai ... Takae Ebihara, Miyako Yamasaki, Takaaki Asamura, Masanori Asada, Kaori Une and Hiroyuki AraiAddress: Department of Geriatrics and Gerontology, Institute of Development, Aging and Cancer, Tohoku ... University, Seiryo-machi 4-1, Aoba-ku, Sendai 980-8575, JapanEmail: Shinsuke Yamanda - debunda@hotmail.com; Satoru Ebihara* - sebihara@idac.tohoku.ac.jp; Takae Ebihara - takae_montreal@hotmail.com;...
- 6
- 334
- 0
Báo cáo y học: "Vacuum-assisted closure device in intensive care unit patients and dissemination of Gram-negative bacteria" pptx
... dedicated portable devices) by nurses and physicians can reduce this critical problem, and during VAC use in particular, a correct sponge appli ca-tion and effi cient planning of vacuum use managed ... In the report of Papanikolaou and colleagues, we under stand that patients developed fi stulas before VAC applications and not as a result of their use. In cases like these, the optimal ... et al.: Vacuum-assisted closure device in intensive care unit patients and dissemination of Gram-negative bacteria. Critical Care 2010, 14:413.Papanikolaou et al. Critical Care 2010, 14:413...
- 2
- 292
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM