Báo cáo y học: " No effect of short-term amino acid supplementation on variables related to skeletal muscle damage in 100 km ultra-runners - a randomized controlled trial" potx
Báo cáo y học: " No effect of short-term amino acid supplementation on variables related to skeletal muscle damage in 100 km ultra-runners - a randomized controlled trial" potx
... have an effect on variables of skeletal muscle damage rather in a multi-stage race than in a single ultra-marathon. It hasbeen shown that the oral administration of amino acidsresulted in a ... RESEARCH ARTICLE Open Access No effect of short-term amino acid supplementation on variables related to skeletal muscle damage in 100 km ultra-runners - a randomized controlled trialBeat Knechtle1,2*, ... supplementation of amino acids before and during a 100 km ultra-marathon had no effect on variables of skeletal muscle damage and muscle soreness.BackgroundApart from the classical marathon distance of 42.195 km, ...
- 8
- 289
- 0
Báo cáo y học: "No effect of omeprazole on pH of exhaled breath condensate in cough associated with gastro-oesophageal reflux" pdf
... purposes)Capsaicin cough challengeCapsaicin (8-methyl-N-vanillyl-6-nonenamide, 98%)obtained from Sigma-Aldrich, Gillingham, UK, was dis-pensed from a nebuliser chamber attached to a breath-activated ... the nongaseous components of the expiratory air. Subjects breathed tidally through a mouthpiece and a two-way non-rebreathing valve, whichalso served as a saliva trap. They were asked to breathe ... oesophageal-tracheobron-chial reflex [7].Exhaled breath condensate (EBC) is a simple non-invasivetechnique for the monitoring of airway inflammation,since it may be representative of the...
- 4
- 255
- 0
Báo cáo y học: " The effect of maternal common mental disorders on infant undernutrition in Butajira, Ethiopia: The P-MaMiE study" pot
... Faculty of Medicine, Addis Ababa University, Addis Ababa, Ethiopia, 6Department of Paediatrics and Child Health, Faculty of Medicine, Addis Ababa University, Addis Ababa, Ethiopia, 7Department ... postpartum depression on maternal-infant interaction: A meta-analysis. Nursing Research 1995, 44:29 8-3 04.19. Tomlinson M, Cooper P, Murray L: The mother-infant relationship and infant attachment ... CMD was relatively low, particularly at the twomonth postnatal time-point. In fully adjusted multivari-able analyses, infant exposure to maternal CMD in preg-nancy, at two months postnatal,...
- 13
- 374
- 0
Báo cáo y học: "The effect of voluntary fasting and dehydration on flicker-induced retinal vascular dilation in a healthy individual: a case report" doc
... practically any change in the quantity and composition of the circulating fluiddue to dehydration and/or fasting is also capable of alter-ing vascular dynamics and BP [13]. Indeed, Alghadyan etal. ... that despite hav-ing comparable intraocular and systemic 'pressure' condi-tions, the retinal vascular reactivity was blunted duringvoluntary fasting in a healthy, young individual. ... Richard Armstrong - r .a. armstrong@aston.ac.uk; Robert Cubbidge - r.p.cubbidge@aston.ac.uk; Sarah Hosking - s.l.hosking@aston.ac.uk* Corresponding author AbstractIntroduction: Dynamic retinal vessel...
- 7
- 356
- 0
Báo cáo y học: " Synergistic effect of human CycT1 and CRM1 on HIV-1 propagation in rat T cells and macrophages" docx
... using the Absolute RNA extraction Kit (Stratagene)and amplified by RT-PCR using the following primers: 5&apos ;- ccgaattcaagcactatggagggagagaggaa-3' and 5'-ccgaattcatgcatagtctggtacatcgtaggggtacttaggaagaggtggaagaggtgg-3'. ... human and mouse CyclinT1(mCycT1), which has a tyrosine at residue 261 in place of the cysteine amino acid in hCycT1, causes almost a com-plete loss of Tat cofactor activity [13,14]. In contrast ... Ohashi T, Yamashita E, Kurosaki Y, Tanaka K, Hakata Y, Komoda Y, Ikeda S, Yokota T, Tanaka Y, Shida H: Enhanced rep-lication of human T-cell leukemia virus type 1 in T cells fromtransgenic rats expressing...
- 12
- 357
- 0
Báo cáo y học: " Transient expression of bC1 protein differentially regulates host genes related to stress response, chloroplast and mitochondrial functions" pptx
... inoculation of bC1 of ChLCB for Q-RTPCR analysisSAA SAA F: GAGACCCGGGATGTCCTGGCAAGAAAGCAT (30 MERS)SAAQPCR:AATTACAAAAGAGCCCCTAAATCCCTAAGC (30 MERS)SAA F2: GGAGAGGGCAACCGATGA (18 MERS)SAA QPCR2: ... 5’-AGGGAACGAG-3’B-18 5’-CCACAGCAGT-3’B-19 5’-ACCCCCGAAG-3’B-20 5’-GGACCCTTAC-3’Table 2 Conclusion of relative quantification methods of differentially expressed genes at two and four days afterinoculationDEG ... GCACCCGCCCAACTCCACGG (17 MERS)SA2 SA2 F: AATACCCGGGATGATAAACATTTGGGGG (30 MERS)SA2 QPCR: CCAATGTCTAGTCTTGATGCAAAATCAA (30 MERS)SA2 F2: CTAGTAAAGTTTTATGGATTCTTGGA (17 MERS)SA2 QPCR2: ATGGATAATAGGGTGATCAGT...
- 12
- 402
- 0
Báo cáo y học: "Successful resuscitation of an elderly man with deep accidental hypothermia using portable extracorporeal circulation in the emergency department: a case report" pps
... pressure became unobtainable. Hearrived on a backboard with a cervical collar in place, histrachea intubated, and a 20 gauge intravenous line infus-ing 0.9% NaCl. Cardiopulmonary resuscitation (CPR)was ... emergencypercutaneous veno-arterial femoral-femoral bypass in theED using a self-contained, portable cardiopulmonarybypass (CPB) support system (PBS Portable Bypass Sys-tem, Medtronic, Inc., Minneapolis, ... Gregory J Cerilli - gregory.cerilli@utoledo.edu; Shuab Omer - shuab.omer@utoledo.edu; Anthony L Braida - anthony.braida@utoledo.edu; Ali M Hassan - ali.hassan@utoledo.edu* Corresponding author AbstractIntroduction:...
- 5
- 308
- 0
Báo cáo khoa học: " The effect of methyl sulphonyl methane supplementation on biomarkers of oxidative stress in sport horses following jumping exercise" doc
... has been pro-posed to constitute a defence system against oxidative andinflammatory damage [8]. Both NO and CO activate sol-uble-guanilyl cyclase (sGC), thus inducing and increase in intracellular ... has anti-inflammatoryeffects involving the mitogen-activated protein kinase path-way. Nature Med 2000, 6:42 2-4 28.40. Henningsson RAP, Lundquist I: Evaluation of islet heme oxygen-ase-CO and ... inflammatory cas-cade [5]. Two molecules that have been recently involved in oxidative damage and inflammatory response are Nitricoxide (NO) and Carbon monoxide (CO). Nitric oxide canact as...
- 9
- 296
- 0
báo cáo hóa học:" Nutrition outcomes of HIV-infected malnourished adults treated with ready-to-use therapeutic food in sub-Saharan Africa: a longitudinal study" ppt
... outcomes of HIV-infectedmalnourished adults treated with ready -to- use therapeutic food in sub-Saharan Africa: a longitudinal study. Journal of the International AIDSSociety 2011 14:2.Ahoua et al. ... Ciliberto HM,Manary MJ: Comparison of home-based therapy with ready -to- usetherapeutic food with standard therapy in the treatment of malnourished Malawian children: a controlled, clinical effectiveness ... malnourishedadults treated with ready -to- use therapeutic food in sub-Saharan Africa: a longitudinal studyLaurence Ahoua1*, Chantal Umutoni2, Helena Huerga3, Andrea Minetti1, Elisabeth Szumilin4,...
- 9
- 407
- 0
Báo cáo y học: No associations of Helicobacter pylori infection and gastric atrophy with plasma total homocysteine in Japanes
... pylori infection to hyper-homocysteinemia. 5. Conclusion This study was the first study that analyzed as-sociation between H. pylori infection and hyperhomo-cysteinemia in normal subjects taking ... 71: 43 7-9 . 25. Patel P, Mendall MA, Carrington D, et al. Association of Helico-bacter pylori and Chlamydia pneumoniae in fections with coronary heart disease and cardiovascular risk factors. ... was unknown. Anyway, gastric atrophy may not increase a risk of lower folate. H. py-lori infection was not significantly associated with lower folate level and hyperhomocysteinemia. The last...
- 7
- 578
- 1
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyento evaluate the effect of the natural conditions and social economical conditions to the rose production in me linh communebáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcmai hồng bàng và cộng sự 2006 đặc điểm siêu âm siêu âm doppler màu và giá trị của nó trong chẩn đoán ung thư biểu mô tế bào gan y học việt nam số đặc biệt 329 tr 189 195báo cáo y tế học đường trường tiểu họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)