0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Two-dimensional power Doppler-three-dimensional ultrasound imaging of a cesarean section dehiscence with utero-peritoneal fistula: a case report" pdf

Báo cáo y học:

Báo cáo y học: " laboratory driving simulation for assessment of driving behavior in adults with ADHD: a controlled study" docx

... information from the laboratory at M.I.T with thedata at the laboratory at Massachusetts general Hospital.BR: Worked closely with all authors on the design andanalysis of the driving data.JFC: ... full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.References1. Faraone S, Biederman J, Mick E: The Age ... limit.This aspect of driving behavior was measured as a proxy of hyperactivity. Lane position was measured as the variabil-ity of the driver's position within lane. Reaction time wasmeasured as...
  • 7
  • 421
  • 0
Báo cáo y học:

Báo cáo y học: "vitamin B12 status in patients of Turkish and Dutch descent with depression: a comparative cross-sectional study" pot

... general physical examination was conducted to excludethe possibility of a physical cause of the psychiatric illness. A laboratory examination was also performed that cov-ered electrolytes, hepatic ... and ratiodata with a normal distribution were tested with the par-ametric Student t test. Interval and ratio data without a normal distribution and data of an ordinal measuringlevel was tested ... and drafted the man-uscript. All authors read and approved the finalmanuscript.References1. Pezawas L, Meyer-Lindenberg A, Goldman AL, Verchinski BA, ChenG, Kolachana BS, Egan MF, Mattay VS,...
  • 5
  • 674
  • 0
Báo cáo y học:

Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot

... ATATTTATACGCCTTTTGATTCCT 297GGTACCCGTAGAGCTTCCGTTCCα2M GCCCGCTTTGCCCCTAACA 359TCGTCCACCCCACCCTTGATGRECK GTAATTGCCAAAAAGTGAAA 352TAGGTGCATATAAACAAGAAGTAADAMTS-1 GCTGCCCTCACACTGCGGAAC 264CATCATGGGGCATGTTAAACACADAMTS-4 ... 287AATAGCTTTACGGGTTTCAGGTIMP-1 TGGGCACCTGCACATCACC 277CATCTGGGCCCGCAAGGACTGTIMP-2 ATAGTGATCAGGGCCAAAGCAGTC 277TGTCCCAGGGCACGATGAAGTCTIMP-3 GATGTACCGAGGATTCACCAAGAT 356GCCGGATGCAAGCGTAGTTIMP-4 ATATTTATACGCCTTTTGATTCCT ... 347GCCCCACTTGCGGTCATCATCGTAMMP-3 TTAGAGAACATGGGGACTTTTTG 360CGGGTTCGGGAGGCACAGMMP-8 ATGCTGCTTATGAGGATTTTGACA 101GCCTGGGGTAACCTTGCTGAGTAMMP-9 CGCCACCACCGCCAACTACG 350GGGGGTGCTCCTCTGTGAATCTGTMMP-12 TGTGACCCCAATATGAGTTTT...
  • 12
  • 526
  • 0
Báo cáo y học:

Báo cáo y học: "Dietary Use and Conservation Concern of Edible Wetland Plants at Indo-Burma Hotspot: A Case Study from Northeast India" doc

... states of India (namely ArunachalPradesh, Assam, Meghalaya, Manipur, Mizoram, Naga-land, and Tripura) form an integral part of the Indo-Burma centre of biodiversity hotspot of global signifi-cance ... 8Nymphaea nouchali Tharo-angangba 2 2 2 2 8Nymphaea pubescens Tharo-ashangba 2 2 2 2 8Nymphaea stellata Thariktha 2 2 2 2 8Nymphoides indica Thariktha-macha 2 2 2 2 8Oenanthe javanica Komprek ... inSagittaria sagittifolia and Polygonum barbatum; for mag-nesium in Viola pilosa and in Eleocharis dulcis; for copperin Lemanea australis and Alpinia galanga; and for zinc inLemanea australis and...
  • 17
  • 458
  • 0
Báo cáo y học:

Báo cáo y học: "Pulmonary stenosis development and reduction of pulmonary arterial hypertension in atrioventricular septal defect: a case report" pdf

... ventricular systolic pressurewas 85 mmHg and pulmonary artery (PA) systolic pres-sure almost systemic at 75 mmHg with pulmonary to sys-temic vascular resistance ratio of 0,3, and pulmonary-systemic ... 2006 and 2008.They highlighted a late and progressive development of a valvular and infundibular pulmonarystenosis leading to a normalisation of pulmonary arterial pressures. At the age of 24 ... was admitted to hospital for repeatedsyncopes and increased dyspnea. He was treated for a severe pulmonary arterial hypertension (PAH), secondaryto atrio-ventricular septal defects (AVSD) associated...
  • 5
  • 370
  • 0
Báo cáo y học:

Báo cáo y học: " Atypical right diaphragmatic hernia (hernia of Morgagni), spigelian hernia and epigastric hernia in a patient with Williams syndrome: a case report" ppsx

... epigastric hernia in a patient with Williams syndrome: a case reportFarhan Rashid*1, Ramakrishna Chaparala2, Javed Ahmed2 and Syed Y Iftikhar2Address: 1Division of GI Surgery, Clinical ... show any abnormality in a patient with intermittent herniation. CT is the modality of choice for diagnosis of Morgagni's hernia and diagnosismay be established by the presence of a fatty mass ... Farhan Rashid* - farhan.rashid@nottingham.ac.uk; Ramakrishna Chaparala - drchaparala@hotmail.com; Javed Ahmed - drjavedahmed88@yahoo.co.uk; Syed Y Iftikhar - ifti@netcomuk.co.uk* Corresponding author...
  • 4
  • 275
  • 0
Báo cáo y học:

Báo cáo y học: "Marked disability and high use of nonsteroidal antiinflammatory drugs associated with knee osteoarthritis in rural China: a cross-sectional population-based survey" ppt

... the heavy physical demands of farming o r timely availability of knee-replacement sur-gery may be cost-effective measures to reduce this bur-denofpainanddisabilityandpossible NSAIDs-relatedcomorbidity.AbbreviationsBMI: ... engaged in heavy occupational physical activity throughout their life span. The aim of this surveywas to estimate the burden of disability, analgesia, and health services use associated with ... marlene.fransen@sydney.edu.au2Faculty of Health Sciences, University of Sydney, East Street, Lidcombe 1825,AustraliaFull list of author information is available at the end of the articleLing et al....
  • 7
  • 356
  • 0
Báo cáo y học:

Báo cáo y học: "The association between microvascular and macrovascular endothelial function in patients with rheumatoid arthritis: a cross-sectional study" pdf

... Yeung AC: Close relation of endothelial function in the human coronary and peripheral circulations.J Am Coll Cardiol 1995, 26:1235-1241.10. Takase B, Hamabe A, Satomura K, Akima T, Uehata A, ... endothelial-independent (glyceryl trinitrate-mediated dilation) macrovascular vasodilatory function.Vasodilatory function was calculated as the percentage increase after each stimulus was applied ... of theTable 1 General and disease-related characteristics forthe RA patients a Characteristics RA patient dataGeneral characteristicsAge, years 57 (47 to 65)Females, % 73%Body mass index...
  • 5
  • 295
  • 0
Báo cáo y học:

Báo cáo y học: " No genetic evidence for involvement of Deltaretroviruses in adult patients with precursor and mature T-cell neoplasms" doc

... Isola-tion of a new type C retrovirus (HTLV) in primary uncul-tured cells of a patient with Sézary T-cell leukaemia. Nature1981, 294:268-271.5. Kalyanaraman VS, Sarngadharan MG, Robert-Guroff ... Miyoshi I, Hatakeyama N, Murakami K, Sawada T, Takimoto Y: Sézary syndrome in an HTLV-I-seronegative, genome-posi-tive Japanese. Am J Hematol 1998, 57:184-185.28. Ellerbrok H, Fleischer C, Salemi ... the ClustalX software [35].Phylogenetic analysisThe PHYLIP program package [36], version 3.65 forMacOS X, with the program modules dnacomp and draw-gram was used with the default parameters...
  • 7
  • 428
  • 0
Báo cáo y học:

Báo cáo y học: "Filter survival time and requirement of blood products in patients with severe sepsis receiving drotrecogin alfa (activated) and requiring renal replacement therapy" pptx

... received a full course of DrotAA and a minimum of eight days of RRT.Patients' demographic information, markers of disease sever-ity, biochemical and haematological data, details of anticoagu-lation ... alfa (activated) (DrotAA) in addition to the indicated anticoagulation during the DrotAA period. When no additional anticoagulation was administered filters were anticoagulated with DrotAA alone ... was madeduring the DrotAA infusion period between patients whoreceived DrotAA without any additional anticoagulation, andpatients who received DrotAA with additional anticoagulation– heparin...
  • 6
  • 215
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềncáo cáo y họcứng dụng công nghệ tế bào trong y họcứng dụng của công nghệ tế bào trong y họcứng dụng di truyền học tế bào trong y họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ