Báo cáo y học: "Resolution of cast nephropathy following free light chain removal by haemodialysis in a patient with multiple myeloma: a case report" ppsx

... citation purposes)Journal of Medical Case ReportsOpen Access Case reportResolution of cast nephropathy following free light chain removal by haemodialysis in a patient with multiple myeloma: ... fibrosis and tubular atrophy. Following rehydration,chemotherapy and free light chain removal using high cut-off haemodialysis, free light chain concentrations fell to less than 5% of the starting ... wishes, haemodialysis was discontinued. Creatininelevel at this point was 650 μmol/litre.At 1 year after discontinuation of dialysis, the patient remains symptomatically well and the myeloma is in remission....

Báo cáo y học: "Resolution of cell-mediated airways diseases Carl G Persson*1 and Lena Uller2" pps

... resolution of airway inflammation.Transepithelial egression of inflammatory cells at clinical improvement of airways diseaseEosinophils In animal models of allergic airway inflammation[11,13,26] airway ... Importantly, with a delay of about two hours also the nasal airway lumen mast cellsexhibited a progressive increase in numbers. As with many other aspects of nasal mucosal inflammatoryresponses ... drug-induced inhibition of transepithelial migration of airway wall leukocytes. It helps interpretation of common airway lumen data, and suggests approaches to treat cell-mediated airway inflammation.IntroductionMechanisms...

Báo cáo y học: " Resolution of LPS-induced airway inflammation and goblet cell hyperplasia is independent of IL-18 J Foster Harris1, Jay Aden1, C Rick Lyons2 and " doc

... analyzedusing a two-way analysis of variance (ANOVA); valuesthat were considered significantly different from eachother by ANOVA were further analyzed using a post-hocTukey's t test. Data having ... lev-els of chemokines and cytokines in the BALF that havebeen reported to be important in recruiting and activatinginflammatory cells to the airways and those that play a role in mucin synthesis and ... similar in both proximal (airway generation 5) and distal (airwaygeneration 11) airways.Non-mucus cells per millimeter basal lamina (BL)remained statistically unchanged with approximately 90–120...

Báo cáo y học: "Identification of clinical and simple laboratory variables predicting responsible gastrointestinal lesions in patients with iron deficiency anemia"

... identified 1 gastric and 1 colon cancer patient in our study. An early gastric cancer was di-agnosed on biopsy of a suspicious ulcerated area in a 45-year-old man patient. Partial gastrectomy was su ... of ab -dominal pain, abdominal pain with hungry and an -xiety, abdominal distension, nausea, vomiting, poor appetite and symptoms of gastroesophageal reflux. All patients were graded 1 to ... their family. At ad-mission, significant physical examination findings of 91 patients; 2 had hepatomegaly, 1 had splenomegaly and 8 had epigastric sensitivity (Table 2). 18 of 89 patients had...

Báo cáo y học: " Preparation of RGD-modified Long Circulating Liposome Loading Matrine, and its in vitro Anti-cancer Effects"

... evaluation of liposomal chloroquine diphosphate loaded by a transmem-brane pH-gradient method. Int J Pharm. 2008; 361:56-63. 22. Maitani Y, Aso Y, Yamada A, et al. Effect of sugars on storage ... (Sigma-Aldrich) was added to each well. Finally, the absorbance of each well was meas-ured at 570 nm. All MTT assays were repeated two times. The relative growth rate was calculated as A5 70 ... Statistical analysis The SAS statistical software was used for statis-tical analyses. The results are expressed as the means ± standard deviations, and samples were subjected to multiple analysis of...

Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

... complex of lactoferrin with a lanthanide ion (Sm3+)at3. 4A ˚resolution. Acta Crystallogr. D55,1799–1804.36. Kitamura, T., Gatmaitan, Z. & Arias, I.M. (1990) Serial quanti-tative image analysis ... solution was prepared by mixing YbCl3andapo-Tf solutions in a molar ratio of 2.5 : 1 and the free Ybwas removed by ultraﬁltration. As indicated in the Resultssection, with this molar ratio apo-Tf ... lM.Itisonly30%saturatedwithironinbloodplasmaand has the capacity for binding to other metal ions of therapeutic and diagnostic interest [16]. Therefore, it hasbeen suggested that Tf can act as a nature...

Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx

... that cyclosporin A (CsA), vinblastine, and valinomycin (and several otherdrugs; N. Nagy, K. Goda, F. Fenyvesi & G. Szabo´Jr,unpublished data)1interactwithPgpinsuchamannerthatpreincubation ... at 37 °C in an incubator containing 5%CO2and maintained by regular passage in Dulbecco’sminimal essential medium (supplemented with 10% heat-inactivated fetal bovine serum, 2 mML-glutamine ... phenomenoninvolving UIC2 and MM12.10 mAbs [22] were affected by pharmacological modulation of the ATPase cycle in a parallel manner. Near the catalytic transition state stabilized by Vior BeFx, Pgp apparently...

Báo cáo Y học: Secretion of egg envelope protein ZPC after C-terminal proteolytic processing in quail granulosa cells doc

... Antibodies: A laboratory Manual.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NewYork.37. Kohsaka, T., Takahara, H., Sasada, H., Kawarasaki, T., Bamba,K., Masaki, J. & Tagami, S. ... transportedselectively from the Golgi apparatus toward the apicalsurface of granulosa cells, which are apposed to the PL. In polarized Madin–Darby canine kidney cells, the O-glyco-sylated domain has critical ... Hatsuzawa,K., Ikemizu, J., Murakami, K. & Nakayama, K. (1991) Arg-X-Lys/Arg-Arg motif as a signal for precursor cleavage catalyzed by furin within the constitutive secretory pathway. J. Biol. Chem....

Báo cáo y học: "Effect of increasing intraperitoneal infusion rates on bupropion hydrochloride-induced seizures in mice" pptx

... study, the animals were maintained in a facility fully accredited by the Standards Council of Can-ada (SCC) and the care and use of the animals was con-ducted in accordance with the guidelines ... in the hazard (probability) of a mousehaving a convulsion when the infusion rate increases by 1min. This hazard ratio is consistent with the odds ratioobtained by logistic regression analysis ... cage cardindicating group, animal number and sex. All animalswere acclimated to their cages and to the light/ dark cyclefor a period of 7 days prior to surgery and for at least 1additional...

Báo cáo y học: "Analysis of normal and osteoarthritic canine cartilage mRNA expression by quantitative polymerase chain reacti" potx

... ProbeADAMTS5 TGGGTTCCCAAATATGCAG CTGTCCCATCCGTCACCT CTGGGAGA1AGC1 GGGACCTGTGTGAGATCGAC GTAACAGTGGCCCTGGAACT AGGAGCTGBGN CAGAACAACGACATCTCAGAGC TCACCAGGACGAGAGCGTA CTCCACCACOL 1A2 CTATCAATGGTGGTACCCAGTTT ... ACTCTGGGATCACGCATGT CTGCCTTCLUM ACCTGGAAATTCTTTTAATGTATCATC CGGTATGTTTTTAAGCTTATTGTAGGA TGCTGGAGMMP13 CCGCGACCTTATCTTCATCT AACCTTCCAGAATGTCATAACCA AGAGGCAGRPL1 3A CTGCCCCACAAGACCAAG GGGATCCCATCAAACACCT ... ATGGGCTGTGAGTGCAAGAT CACTCATCCGGAGACGAGAT CTGCCCCATIMP4 GCAGAGAGAAAGTCTGAATCATCA GGCACTGTATAGCAGGTGGTAA TGTGGCTGTNC TGGATGGGACAGTCAAGGA GCTCAGCTCTGCCAGGTTA CCACCTCCVIM TACAGGAAGCTGCTGGAAGG CCTCAGGTTCAGGGAAGAAA...

Xem thêm

Từ khóa: báo cáo y học báo cáo y học cổ truyền mẫu báo cáo y học cổ truyền báo cáo khoa học y học báo cáo y tế học đường mẫu báo cáo y tế học đường Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam