0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Array comparative genomic hybridisation-based identification of two imbalances of chromosome 1p in a 9-year-old girl with a monosomy 1p36 related phenotype and a family history of learning difficulties: a case report" pps

Báo cáo y học:

Báo cáo y học: "Array comparative genomic hybridisation-based identification of two imbalances of chromosome 1p in a 9-year-old girl with a monosomy 1p36 related phenotype and a family history of learning difficulties: a case report" pps

... chromosome 1p in a 9-year-old girl with a monosomy 1p3 6 related phenotype and a family history of learning difficulties: a case reportGregory J Fitzgibbon*1, Jill Clayton-Smith2, Siddharth Banka2, ... result of a de-novo rearrangement or as a consequence of malsegregation of a balanced parentaltranslocation at meiosis. Case presentation: Array comparative genomic hybridisation analysis of a 9-year-old ... lip/palatefound in 17% of monosomy 1p3 6 patients. An epilepsycandidate gene KCNAB2 was found to be deleted in themajority of seizure prone 1p3 6 patients, and humangamma-aminobutyric acid A receptor...
  • 6
  • 376
  • 0
Báo cáo y học:

Báo cáo y học: "Pancreas divisum and duodenal diverticula as two causes of acute or chronic pancreatitis that should not be overlooked: a case report" doc

... hyp-oechogenic area adjacent to the head of the pancreas. Itwas initially diagnosed as a cystic lesion of the pancreas.Laboratory examinations showed an increase in the levels of amylase (306 U/liter, ... pancreatitis due to a combination of PD and duo-denal diverticulum. Case presentation A 75-year-old man with a clinical history of recurrent pan-creatitis (more than two episodes of acute pancreatitis)without ... mg/dl). A diagnosis of acute edematous pancreatitis was made.The patient's clinical condition improved significantlyafter 5 days of pharmacological treatment in hospital with gabexate mesylate,...
  • 4
  • 267
  • 0
Báo cáo y học:

Báo cáo y học: " Microarray-based genomic surveying of gene polymorphisms in Chlamydia trachomatis" ppsx

... function among phenotypicallydistinct strains.Materials and methodsBacterial strains, growth conditions, and preparation of genomic DNAC. trachomatis strains (A/ Har1, B/TW-5, Ba/Apache-2, ... Visconti for assistance in printingthe microarray slides and Jeanne Moncada for help in the propagation of several of the chlamydial strains. We also thank George F. Sensabaugh forinput and suggestions ... Chlamydial evolution: a billion years and counting. In Chlamydial Infections, Proceedings of the Tenth InternationalSymposium on Human Chlamydial Infections:16-21 June 2002. Antalya,Turkey Edited...
  • 9
  • 545
  • 0
Báo cáo y học:

Báo cáo y học: " Unraveling the genomic diversity of small eukaryotes" potx

... the plant family Brassicaceae, while a third has made a host jump across plant families and is a parasite of members of the family Resedaceae.The sequences of metagenomes - the total DNA of ... and several independent lineages of unicellular microorganisms. Communications from Nicole King (University of California, Berkeley, USA), Franz Lang (University of Montreal, Canada) and Inaki ... more than 17,500 genes and is very rich in gene and segmental duplications. The origin of the Metazoa is a landmark event in the history of life and we are now taking critical steps in the...
  • 3
  • 279
  • 0
Báo cáo y học:

Báo cáo y học: " Integrating diverse genomic data using gene sets" ppt

... related to sugar metabolic processes. E1 and E2 – single data type analysis using expression data; C1 and C2 – single data type analysis using copy number data. marginally outperforms the integrative ... by integrative and meta-analytic approaches but not by any of the single-data-type analyses (see Methods for details). The Meta-analytic approaches show minimal improvement over single-data-type ... would individually if they are highly correlated. Our approach will adjust for varying reliability across data types: if the noise in a data type doubled, this data type would automatically contribute...
  • 42
  • 214
  • 0
Báo cáo y học:

Báo cáo y học: "Array-based techniques for fingerprinting medicinal herbs" doc

... are fast and cheap, and capable of fingerprinting the species with sequence information available in the existing databases. In contrast, sequence-independent arrays are laborious and costly but ... [4].Development and acceptance of herbal medicine arehindered by misidentification and adultera tion of medic-inal herbs which may lead to loss of therapeutic pot ency and po tential intoxication [5]. Authentication ... of manufacturing a suppression subtractive hybridization-based microarray and using it for finge rprinting herbalplants. Fingerprinting herbal species using a single dye system is shown in the...
  • 10
  • 134
  • 0
Báo cáo y học:

Báo cáo y học: "An annotation infrastructure for the analysis and interpretation of Affymetrix exon array data" pot

... Stratagene's ArrayAssist®.Many of them are extensions of previously known softwareproducts for standard arrays, and their major analytical aimsoverlap with those available in exonmap and BioConductor/R, ... genome annotation and probesetlocation data that led to the development of a single inte-grated database rather than building a database containingonly probe and probeset hits, and making use of ... BioConductor/R, that is, differential expression analysis and splicing analy-sis. None of the commercial software suites allow integration with the analytical libraries of R and all are proprietary and licensed,...
  • 9
  • 598
  • 0
Báo cáo y học:

Báo cáo y học: " Rats go genomic" ppt

... a significant change in the expression of a specific gene, in a panel of phenotypically characterized rat recombinantinbred strains. This systematic approach resulted in themapping of many novel ... Genomics and Models’ meeting in 2003, several labs have produced a total of 15 targeted ethylnitrosourea (ENU)-induced knockoutmodels and over 60 mutants with amino-acid replacements in a variety of ... and the adenomatous polyposiscoli (APC) knockout by James Amos-Landgraf (McArdleLaboratory for Cancer Research, Madison, USA). Interest-ingly, these both revealed striking differences in phenotypescompared...
  • 3
  • 172
  • 0
Báo cáo y học:

Báo cáo y học: " Introducing the Critical Care Forum’s ongoing review of medical statistics"

... calculations;measures of disease; parametric and non-parametric tests;simple regression; and analysis of survival data. Ideally theseries will evolve to meet the needs of Critical Care readers, and you are encouraged ... widespread use, itis important that all those involved in research or themanagement of patients have a sound grasp of at least thebasics of statistical methods. Unfortunately, in practice this ... providing a simple introduction and/ orrefresher to some of the more common tools and ideas used in medical statistics. The articles are aimed at a non-specialistaudience and will keep algebra and...
  • 2
  • 471
  • 0
Báo cáo y học:

Báo cáo y học: "Emulsified Isoflurane Preconditioning Reduces Lung Injury Induced By Hepatic Ischemia/Reperfusion in Rats"

... 5'- CTTCAAGCTGAGCGACATTGG -3' (forward) and 5'- AGCATGAGAAATTGGCTCCGT -3' (reverse) for ICAM-1 and 5'- ACCACAGTCCATGCCATCAC -3' (forward) and 5'- TCCACCACCCTGTTGCTGTA ... electrophoresed in a 1.5% agarose gel and stained with ethidium bromide. The intensity of each ICAM-1 mRNA band was quantified by densi-tometry using a gel documentation and analysis sys-tem and normalized ... is as-sociated with activation of inflammatory reaction, including the increased activity of NF-κB and the in- creased inflammatory mediators such as TNF-α and ICAM-123. The results of...
  • 9
  • 389
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM