Báo cáo y học: "Fast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case report" pptx

... Case ReportsOpen Access Case reportFast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case reportJens Waldmann*1, Nils Habbe1, Volker ... programs in patients with multiple endocrine neoplasia type 1 are intended to detect and treat malignant tumors at theearliest stage possible. Malignant neuroendocrine pancreatic tumors are the ... postoperatively in the case of a newly diagnosed lesion, taking into consider-Histological characteristics of the neuroendocrine tumor at initial operation and the neuroendocrine carcinoma of the pan-creas...

báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx

... this article as: Griniatsos et al.: Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novelmutation in the MEN1 gene. World Journal of Surgical ... 2005,89:143-150.11. Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E,Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 genecausing familial isolated primary hyperparathyroidism. ... IA, Skarulis M, Li G, Moon YW, Park WS, Weil R,Barlow C, Spiegel AM, Marx SJ, Zhuang Z: Multiple endocrine neoplasia type 1: atypical presentation, clinical course, and genetic analysis ofmultiple...

Báo cáo Y học: Double-stranded RNA-activated protein kinase interacts with apoptosis signal-regulating kinase 1 Implications for apoptosis signaling pathways docx

... Japan;2Graduate school of Medical Science, Kanazawa University, Kanazawa, Ishikawa, JapanDouble-stranded RNA-activated protein kinase (PKR), a serine/threonine kinase, is activated in virus-infected ... precise pathway linking PKR and the MAPKfamily remains to be elucidated.Apoptosis signal-regulating kinase 1 (ASK1) is a MAPKkinase kinase (MAPKKK) that acts upstream of JNK andp38 MAPKs [14,15]. ... conjugated with ﬂuorescein isothiocya-nate (FITC) (MBL, Nagoya, Japan) or anti-(rabbit IgG)conjugated with tetaramethyl rhodamine isothiocyanate(RITC) (Jackson Immunoresearch Laboratory, WestGrove,...

Báo cáo y học: "Treatment of psychotic symptoms in bipolar disorder with aripiprazole monotherapy: a meta-analysis" pps

... sedation, but no data on psy-chotic symptoms are analysed. Additionally, there is a concern regarding aripiprazole and olanzapine mainte-nance data because the relevant studies included patientswho ... percentage).Trial Target Overall side effects Anxiety Agitation Acathisia Constipation Headache Hyperprolactinaemia Insomnia Nausea SedationCN138-009 Mania 8 1 9 7 5 -6 6 13 15CN138-074 Mania 6 ... and bipolarII disorders: dose-response relationship with bipolar familyhistory. Psychopathology 2008, 41(1):39-42.10. Selva G, Salazar J, Balanza-Martinez V, Martinez-Aran A, Rubio C,Daban...

Báo cáo y học: "Traumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracture" pptx

... T, Karampelas Ioannis, Karydas Georgios, Karabinis Andreas:Unilateral and bilateral vertebral artery dissection followingmotor vehicle injury – two cases and a mini-review. Interna-tional Journal ... purposes)Journal of Brachial Plexus and Peripheral Nerve InjuryOpen Access Case reportTraumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracturesSilas ... Dill-Macky Marcus J, Khangure Mark, Song Swithin: Traumatic cer-vical distraction complicated by delayed reduction due totraumatic vertebral artery pseudo-aneurysm. AustralasianRadiology 1999,...

Báo cáo y học: "Ketamine as an adjuvant in sympathetic blocks for management of central sensitization following peripheral nerve injury" pptx

... treatment of a nine -year old case of Complex Regional Pain syndrome Type I [ReflexSympathetic Dystrophy] with intravenous Ketamine – Infu-sion therapy in a warfarin anticoagulated adult female patient. ... thalamocortical dissociation affected by Ket-amine may have a role to play in its therapeutic action. Allthe patients in this case series had heat allodynia andresponded to sympatholysis with Ketamine. ... Neuropathic pain scale score [16]. Ourpatients exhibited SMP along with heat and mechanicalallodynia.Ketamine has been administered orally, as an ointment,intravenously, subcutaneously, epidurally...

Báo cáo y học: "Near full-length genome analysis of low prevalent human immunodeficiency virus type 1 subclade F1 in São Paulo, Brazil" docx

... Santos AF, Sousa TM, Soares EA, Sanabani S, Martinez AM, Sprinz E,Silveira J, Sabino EC, Tanuri A, Soares MA: Characterization of a new circulating recombinant form comprising HIV-1 sub-types ... F1 sequences obtained in this study dis-played open and intact reading frames for majority of HIVproteins. To exclude laboratory strains contamination, a BLAST search of GenBank HIV-1 sequences ... found a close phylogenetic relationship between Angolan andRomanian HIV-1 subtype F1 isolates and thus lent furthersupport to available published data that indicated an Afri-can origin of subtype...

Báo cáo y học: " Gene promoter methylation assayed in exhaled breath, with differences in smokers and lung cancer patients" ppt

... bp(-240~+50)PAX5β-TFPAX5β-TRCGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC301 bp(-92~+141)Quantitative MSP primersDAPK-qFDAPK-qRAG(C/T)G(C/T)GGAGTTGGGAGGAGTACAAAC (A/ G)ACCAATAAAAACCCTACAAAC121 ... PrimerRASSF 1A- TFRASSF 1A- TRCGACTCCTGCACTCATTAACCCTCACTAAAGAGGGT(T/C)GGATGTGGGGATTTGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCCCAAAATCCAAACTAAAC337 bp(-254~+39)DAPK-TFDAPK-TRCGACTCCTGCACTCATTAACCCTCACTAAAGTGGGTGTGGGG(T/C)GAGTGGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTCC (A/ G)C (A/ G)AAAAAAACAAAATC358 ... bp(-254~+39)DAPK-TFDAPK-TRCGACTCCTGCACTCATTAACCCTCACTAAAGTGGGTGTGGGG(T/C)GAGTGGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTCC (A/ G)C (A/ G)AAAAAAACAAAATC358 bp(-240~+50)PAX5β-TFPAX5β-TRCGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC301...

Báo cáo y học: " Surfactant disaturated-phosphatidylcholine kinetics in acute respiratory distress syndrome by stable isotopes and a two compartment model" potx

... technique includes bothintracellular surfactant and non-surfactant membranesthat, with time, incorporate a fraction of administereddisaturated-phosphatidylcholine.Surfactant in ARDS In patients with ... Italy, 3Department of Pharmacology, Anaesthesia and Critical Care, University of Padova, Padova, Italy, 4Respiratory Unit, General Medical Hospital, Padova, Italy, 5Department of Medical ... that the sys-tem was at steady state, thus allowing the use of a lineartime invariant compartmental model to describe disatu-rated-phosphatidylcholine kinetics.Data were analysed according...

Báo cáo y học: " Peripheral blood B lymphocytes derived from patients with idiopathic pulmonary arterial hypertension express a different RNA pattern compared with healthy controls: a cross sectional study" pdf

... screening. Leuk Lymphoma2007, 48(5):978-986.27. Hatanaka H, Takada S, Choi YL, Fujiwara S, Soda M, Enomoto M,Kurashina K, Watanabe H, Yamashita Y, Sugano K, Mano H: Trans-forming activity of ... his laboratory for their most valuable technical assistance with B cell purification and char-acterization and to Ted Shade in the microarray core facility for assistance with data analysis.References1. ... RNAmicroarray was performed.Microarray data generationRNA quality assessment, sample preparation, reverse tran-scription, labeling, high-density oligonucleotide arrayhybridization, scanning...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP