báo cáo khoa học: " Harm reduction and equity of access to care for French prisoners: a review" potx

... use and sexual behaviors prior to and during incarceration, tattoo-ing, access to medical care and past medical history wasprovided to all inmates. Overall, 72% of inmates agreed to participate ... inclusion and exclusion criteria, information was collected and analyzedabout HIV, HBV and HCV prevalence, risk practices, mortality, access to harm reduction measures and care for French prison inmates.Results: ... 11(page number not for citation purposes) Harm Reduction JournalOpen Access Research Harm reduction and equity of access to care for French prisoners: a reviewLaurent Michel†1,2,3, M Patrizia...

Báo cáo khoa học: "The Acquisition and Application of Context Sensitive Grammar for English" docx

... much use in application to natural language applications and there is a broad literature on Aug- mented Phrase Structure Grammar [Gazdar et. al. 1985], Unification Grammars of various types ... where each character ac- tually maps in various contexts into several different phonemes. For accomplishing linguistic case analyses McClelland and Kawamoto [1986] and Miikulainen and 122 ... strings of language for training a neural network. How- ever although the resulting neural network was trained as a satisfactory grammar, there was a problem of scale- up. Training the network for...

báo cáo khoa học: " Harm reduction, methadone maintenance treatment and the root causes of health and social inequities: An intersectional lens in the Canadian context" ppt

... Aboriginal clientsaccessing mainstream mental health and addictions care and primary health care settings and healthcare providers;Results: All client-participants had profound histories of abuse and ... professionals) acceptedMMT as a harm reduction approach, several believedthat it was being used by some in power, such as a few“doctors and pharmacists”, as a means to make money“offofthebacksofaddicts.” ... analysis and interpretation of thedata and drafted the manuscript. AJB was a co-investigator, assisted in thedesign and in all aspects of the study, including the data analysis and interpretation of...

báo cáo khoa học: " Harm reduction services for British Columbia''''s First Nation population: a qualitative inquiry into opportunities and barriers for injection drug users" pdf

... Columbia, Canada and 2Vancouver Coastal Health Authority, Vancouver, British Columbia, CanadaEmail: Dennis Wardman* - dwardman@shaw.ca; Darryl Quantz - Darryl.Quantz@vch.ca* Corresponding author ... V: Pharmacy and Canada's aboriginal peoples:reconcilable differences. Canadian Pharmaceutical Journal 2002,135(9):30-35. Harm Reduction Journal 2006, 3:30 http://www.harmreductionjournal.com/content/3/1/30Page ... find-ings and interpretations of the researcher are taken to informants for verification [8]. In this case, a transcript of the interview and a summary of the final themes weretaken back to participants...

báo cáo khoa học: " Harm reduction in hospitals: is it time?" potx

... respect to addressing ongoing issues related to stig-matization and elevated rates of leaving AMA. This maylend itself to a randomized trial or perhaps it is betterexamined via observational data ... 1BC Centre for Excellence in HIV/AIDS, St. Paul's Hospital Vancouver, Canada, 2Dalla Lana School of Public Health, University of Toronto, Toronto, Canada and 3Department of Medicine, ... was accommodated rather than banned inhospitals, rates of leaving AMA would decline. Whileincorporating harm reduction in hospitals to deal withaddicted patients raises a host of ethical and...

báo cáo khoa học: " Harm Reduction Journal" pps

... accompanied by the original language article (as a PDF), and by detailed abstracts in other languages asappropriate. These translations will be linked to the origi-nal HRJ publication and archived ... archived separately, along with a collection of public access research and documentation of harm reduction policies and programs, creating a multi-lingual text of contemporary international scientific ... research and other scholarly resources, suchas organizational and government reports, provide theopportunity to create a new and more accessible interna-tional standard of publication for...

báo cáo khoa học: " Harm reduction-the cannabis paradox" docx

... compara-tively examine the molecular and cell biology of animals and extrapolate to humans. However, the behavioral rep-ertoire of humans appears to be dramatically enhancedover other animals ... receptor in rats following nerve damage [29].Once again, nature has selected cannabinoids to reduce harm. Smoking and Lung CancerFundamental to any consideration of cannabis-based harm reduction, ... characterized by distortions of reality, disturbances of language and thought processes, and social withdrawal.Certainly, aspects of cannabis intoxication parallel thesesymptoms. It is feared...

Tài liệu Báo cáo khoa học: Afﬁnity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

... internalization and whether the rate con-stants of association and dissociation for [125I]TC-PCSK9 at 37 °C are similar to values obtained at4 °C. Our preliminary data indicate that HepG2 ... per-centage of total radioactivity added. (B) Binding presented as theamount of [125I]TC-labeled ligand speciﬁcally bound. Error bars arestandard deviations for data from three separate experiments. ... surface.Data analysisAll binding and kinetic data were ﬁtted by nonlinear regres-sion with prism 5 (GraphPad Software, CA, USA). For inhibition-binding curves, the raw data were analyzedaccording...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... CGAGCAGGAGATGGGAACC Real-time PCRZfbactin-R CAACGGAAACGCTCATTGC Real-time PCRZfgapdh-F CGCTGGCATCTCCCTCAA Real-time PCRZfgapdh-R TCAGCAACACGATGGCTGTAG Real-time PCRZFil4-F CATCCAGAGTGTGAATGGGA...

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulﬁde isomerase family proteins with nonclassic active center motifs pdf

... 5¢-GACGACGACAAGATGGAGGTTAAGGATGAGTTG-3¢ and 5¢-GAGGAGAAGCCCGGTCTATAACTCATCTTTGAGTAC-3¢ for GmPDIL- 3a, and 5¢ -GACGACGACAAGATGGAGGTTGAGGATGAGTTGG-3¢ and 5¢-GAGGAGAAGCCCGGTTCATAACTCATCTTTGACGAC-3¢ ... with a Thermal Cycler Dice RealTime System (TaKaRa Bio Inc.). Forward primers 5¢-CGTTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CACAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi-trogen Corporation) and reverse ... reverse primers 5¢-AAGTAGGCAACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA-CATGG-3¢ were used for detecting GmPDIL- 3a and GmPDIL-3b, respectively. Primers for quantiﬁcation of actin mRNA were as described...

Xem thêm