báo cáo khoa học: " Whither RDS? An investigation of Respondent Driven Sampling as a method of recruiting mainstream marijuana users" pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... 20 10 FEBS The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3Â UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines ... activator and urokinase-type plasminogen activator are controlled by plasminogen activator inhibitor types 1 and 2 (PAI-1 and PAI -2, respectively). One of the enigmatic featuresof PAI -2 is that, although ... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT Forward (nt 15 52 1585 PAI -2) SJS260 AACTCACCATAGGAATGCATAATAAATAACAAAG Reverse (nt 1585–15 52 PAI -2) SJS261 CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT Forward (nt 15 52 1585...

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... were of analytical grade from Nacalai Tesque (Kyoto, Japan) andWako Pure Chemical Industries (Osaka, Japan).Culture and screening of bacteriaBacterial strains were cultivated for 15–20 h at ... &Komagata K (1992) Transfer of Pseudomonas- Amino-vorans (Dendooren Dejong 1926) to AminobacterGeneral-Nov as Aminobacter-Aminovorans Comb-Novand description of Aminobacter-Aganoensis Sp-Novand ... c, myokinase, enolase, lactate dehydrogenase, andglutamate dehydrogenase from Oriental Yeast, Osaka,Japan.Other analytical methodsThe N-terminal amino -acid sequence of the enzyme wasdetermined...

Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

... toencode a bifunctional enzyme consisting of an RNase H domain and an APase domain. The RNase H and APase activities of the full length SCO2299 proteindepend on its N-terminal RNase H domain and C-ter-minal ... protein also exhib-ited acid phosphatase activity at almost the same level as the C-terminal domain alone. These results indicate that RNase H and acid phosphatase activities of the full length SCO2299 ... NRC-1: archaeal RNase HI cancleave an RNA-DNA junction. Biochem J 381, 795–802.20 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004)Cleavage of double-stranded RNA by RNase HI from a thermoacidophilic...

Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

... MINIREVIEW Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability Marina Pizzi1,2, Ilenia Sarnico1, Annamaria Lanzillotta1, Leontino Battistin3and ... Kitagawa-Sakakida S, Nishimura M,Morishita R, Kaneda Y, Kohmura E, Yoshimine T &Matsuda H (2001) Nuclear factor-kappa B decoy atten-uates neuronal damage after global brain ischemia: a future ... transcrip-tion factor-2, signal transducer and activator of tran-scription 3 and nuclear factor-kappaB (NF-j B) [1]. NF-jB is a key regulator of both inﬂammation andcell death and has been proposed as suitable...

Báo cáo khoa học: "Experience with an Easily Computed Metric for Ranking Alternative Parses" pptx

... Experience with an Easily Computed Metric for Ranking Alternative Parses George E. Heidorn Computer Sciences Department IBM Thomas ... which is itself an extended abstract for a forthcoming paper, describes a metric that can be easily computed during either bottom-up or top-down construction of a parse tree for ranking the desirability ... the performance of this metric, and have found that it is producing very good results. This brief paper, which is actually an extended abstract for a forthcoming paper, begins with an introduction...

Báo cáo khoa học: "EXPERIENCES WITH AN ON-LINE TRANSLATING DIALOGUE SYSTEM" docx

... and ikebana ('flower arranging'). The word ichibana (El) does not exist in Japanese. His explanation 'number one' was correctly translated (not shown here) as ichiban. ... the delay of display. 158 EXPERIENCES WITH AN ON-LINE TRANSLATING DIALOGUE SYSTEM Seiji MHKE, Koichi HASEBE, Harold SOMERS , Shin-ya AMANO Research and Development Center Toshiba Corporation ... translation under normal circum- stances. For example, Engfish I see should be translated as naruhodo rather than watashi ga miru, Japanese wakarimashita should be I under- stand rather than...

Báo cáo khoa học: "Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance" ppt

... to three different approaches to sentence ranking: A simple paragraph-based approach intended as a baseline, two word-based approaches, and two coherence-based approaches. In the paragraph-based ... ( elab ( par ( 0 1 ) 2 ) ). 0Nuc 1Nuc 2Sat elabNucsimelabsim012 Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance ... summarizer. 2 Approaches to sentence ranking 2.1 Paragraph-based approach Sentences at the beginning of a paragraph are usually more important than sentences that are further down in a paragraph,...

Báo cáo khoa học: FLIP and MAPK play crucial roles in the MLN51-mediated hyperproliferation of ﬁbroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis pdf

... 2008 The Authors Journal compilation ª 2008 FEBS FLIP and MAPK play crucial roles in the MLN51-mediated hyperproliferation of ﬁbroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis Ju-Eun ... YS (2006) MLN51 and GM-CSF involvement in the proliferation of ﬁbroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis. Arthritis Res Ther8, R170.8 Cook AD, Braine EL, Campbell ... followed by the blocking of FLS apoptosis. FLIP upregulated by MLN51 plays a crucial role in the anti-apoptosis of MH7A cellsWe examined whether FLIP was involved in the anti-apoptosis of MH7A...

Báo cáo khoa học: "Solitary colonic metastasis from renal cell carcinoma presenting as a surgical emergency nine years post-nephrectomy" pot

... reported case of solitary colonic renal cell carcinoma metastasis presenting as an intra-abdominal bleed, nine years post-nephrectomy.BackgroundThe worldwide incidence of renal cell carcinoma (RCC) ... inany medium, provided the original work is properly cited.Case reportSolitary colonic metastasis from renal cell carcinoma presenting as a surgical emergency nine years post-nephrectomyAlka ... This case rep-resents the first incidence of late colonic RCC metastasis presenting as a surgical emergency in the way of an intra-abdominal bleed.Case Presentation A 65-year-old woman presented...

Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf

... had a semi-cylindrical shape, and calculating the sap flux as the aver-age of the measurements made at a height of 6 m on a sample of ten trees at Car-rasqueira and ... the methods used for extrapolating sap flow data to estimate stand transpiration have remained ratherempirical, with the capacitances in the water transfer process within ... a horizontal plane and suggest methods for improving the accuracy of the estimation of water flux at tree and stand levels.2. AN UNBRANCHED RC MODEL OF TREE WATER FLUX The...

báo cáo khoa học: " Using Mitrofanoff’s principle and Monti’s technique as a surgical option for bladder augmentation with a continent stoma: a case report" pps

... this article as: Cassini et al.: Using Mitrofanoff’s principle and Monti’s technique as a surgical option for bladder augmentation with a continent stoma: a case report. Journal of Medical Case ... 5:49http://www.jmedicalcasereports.com/content/5/1/49Page 3 of 3 CAS E REP O R T Open Access Using Mitrofanoff’s principle and Monti’s technique as a surgical option for bladder augmentation with a continent stoma: a ... in patients with a largeamount of subcutaneous tissue because channel lengthis required to reach the skin and the appendix that isanastomosed at the bladder wall with a nonrefluxinganastomosis.ConclusionThe...

báo cáo khoa học: " Knowledge transfer & exchange through social networks: building foundations for a community of practice within tobacco control" potx

... with social network analytic methods.LimitationsPresentation of the behavioural and social network datato the WATI II attendees for feedback provided a form of validation for the baseline measures; ... com-munity of practice (CoP).Web-Assisted Tobacco Interventions (WATI)WATI is a complex and rapidly changing area of tobacco control research and practice. The WATI rubric is appliedto the broad application ... availability even small changes attributedto a behavioural eHealth intervention can translate into a large population health effect. Tobacco control is a lead-ing area of behavioural eHealth...

báo cáo khoa học: " Adjuncts or adversaries to shared decision-making? Applying the Integrative Model of behavior to the role and design of decision support interventions in healthcare interactions" doc

... AccessDebate Adjuncts or adversaries to shared decision- making? Applying the Integrative Model of behavior to the role and design of decision support interventions in healthcare interactionsDominick L Frosch*1,2, ... measurement burden for investigators and create astandardized method for examining and reporting the determinants of communication behaviors necessary for shared decision- making.Competing interestsDLF ... for investigators grows from the contextual specificity required by the theory. This relatesboth to the context for the behavior of interest as well as to the population that the investigator...

báo cáo khoa học: " Whither RDS? An investigation of Respondent Driven Sampling as a method of recruiting mainstream marijuana users" pdf

... alternative policies such as decriminalization and legal regulation.BackgroundThe widespread use of cannabis (Cannabis sativa/indicaand related species also widely known as &apos ;marijuana& apos;) ... conduct of a chain-referral method that isinnovative and potentially improves on other methods of recruiting mainstream marijuana users.Compared to other smaller populations of drug users, marijuana ... unbiased quantitative data[23,24]. Past studies have relied upon nonrandom sam-pling methods like convenience sampling and snowball/chain-referral that can yield large samples yet offer noassurance...

báo cáo khoa học: " Potential chromosomal introgression barriers revealed by linkage analysis in a hybrid of Pinus massoniana and P. hwangshanensis" ppsx

... 12:172-175.doi:10.1186/1471-2229-10-37Cite this article as: Li et al.: Potential chromosomal introgression barriers revealed by linkage analysis in a hybrid of Pinus massoniana and P. hwangshanensis. BMC Plant Biology 2010 10:37.Submit ... natural hybrid of P. massoniana and P. hwangshanensis. This genetic map is determined by usingmegagametophytes of 192 normally germinated seeds from themapping parent. Marker with name ending ... chromosomal introgression barriers between P. massoniana and P. hwangshanensis. This study provided the basis for asso-ciating S SD markers with their introgression behavior in natural stands, and...

Xem thêm