Báo cáo y học: " Low-intensity blue-enriched white light (750 lux) and standard bright light (10 000 lux) are equally effective in treating SAD A randomized controlled study" pps
Báo cáo y học: " Low-intensity blue-enriched white light (750 lux) and standard bright light (10 000 lux) are equally effective in treating SAD. A randomized controlled study" pps
... measures of irritability and eye discomfort as compared to white light of 4000 °K [29].Exposure to low-intensity blue-enriched white light (750 lux, 17 000 °K) is equally effective as standard ... Anderson et al. [16],who found that blue monochromatic low-intensity light (98 lux) was equally effective in treating SAD as broad-band white light at 711 lux with identical photon density in the ... by YM, LJMS and MJR. YM served as principal investigator. VD participated in the clinicalconduct of the trial and was the research coordinator. EHB contributed tothe statistical data analysis....
- 8
- 457
- 0
Báo cáo y học: "An exploration of how clinician attitudes and beliefs influence the implementation of lifestyle risk factor management in primary healthcare: a grounded theory study" pot
... studyRachel A Laws*, Lynn A Kemp, Mark F Harris, Gawaine Powell Davies, Anna M Williams and Rosslyn Eames-BrownAddress: Centre for Primary Health Care and Equity, School of Public Health and ... L, Fahridin S, Pan Y, O' Halloran J: General Practice Activity in Aus-tralia 2007-2008 Canberra: AIHW Cat No, GEP 22; 2008. 14. Ferketich AK, Khan Y, Wewers ME: Are physicians asking abouttobacco ... alcohol and physical activity1Team and service managers only2Team/service managers and project officers onlyTable 2: Criteria used to theoretically sample interviews to include in the analysisFactors...
- 15
- 708
- 0
Báo cáo y học: "CD47 associates with alpha 5 integrin and regulates responses of human articular chondrocytes to mechanical stimulation in an in vitro model" pdf
... glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5'-CCACCCAT-GGCAAATTCCATGGCA-3' and 5'-TCTAGACGGCAGGT-CAGGTCCACC-3'; and aggrecan, 5'-TGAGGAGGGCTGGAACAAGTACC-3' and 5'-GGAGGT-GGTAATTGCAGGGAACA-3'. A ... to a wide range of mechanicalforces in vivo as part of normal joint movement and loading.Mechanical loading within a physiological range is necessaryfor the maintenance of articular cartilage ... of normal articular cartilage (Collins grade 0)obtained from 1 female (age 67 years) and 7 males (medianage 71 years, range 53 to 88 years) and osteoarthritic carti-lage (Collins grade 1 to...
- 11
- 441
- 0
Báo cáo y học: "Effectiveness of strategies to encourage general practitioners to accept an offer of free access to online evidence-based information: a randomised controlled trial" docx
... the Royal Australian Collageof General Practitioner's National Research and Evalua-tion Ethics Committee.ResultsAge, gender, country of graduation, years since graduation and area of ... and Accessibility/Remoteness Index of Australia (ARIA) wereprovided by Medicare in table format (to protect GP's pri-vacy).Baseline characteristics (age group, gender, country ofgraduation, years since graduation, ... would also like to thank Anne Gibbs and Dr Martin Halperin, who assisted with ethics applications, the clinical audit activity applications to RACGP and ACRRM, initial questionnaire design and...
- 8
- 250
- 0
Báo cáo y học: "Spontaneous internal desynchronization of locomotor activity and body temperature rhythms from plasma melatonin rhythm in rats exposed to constant dim light" docx
... purposes)IntroductionCircadian rhythms in physiology and behavior have beendescribed in a wide variety of organisms ranging from bac-teria to humans. These rhythms are driven by circadianpacemakers that are capable ... assay was 0.2 pg/ml. Intra-Assay variabilitywas 9% and the inter-Assay was 13% (see [15] for moredetails).Analysis of the Rw and Tb rhythms were performed on a 7-day segment of the data ... declare that they have no competing inter-est.Authors' contributionsJA and NMB participated in data collection and data anal-ysis. JA drafted the manuscript. GT directed the study and wrote...
- 6
- 346
- 0
Báo cáo y học: "Oral Rehydration Therapy for Preoperative Fluid and Electrolyte Management"
... serum creatinine, hematocrit, vital signs, preoperative urine volume, urinary sodium, and urinary creatinine. Vital signs were analyzed using the repeat-ed-measures analysis of variance and the ... ASA physical status classification and, basically, was not the patient ap-propriate for the ORT treatment, and it was probable that hyperinflation of the lung was always present in the patient, ... obtained from their attending physicians (because there are risks of a decrease in conscious level, paralysis, and an increase in intra-cranial pressure in neurosurgical patients as well as...
- 9
- 489
- 0
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"
... (5’→3’) Anticipated length (bp) D-Loop ATTCTAACCTGAATCGGAGG GATGCTTGCATGTGTAATCT 1528 ATPase8 CCCGGACGTCTAAACCAAACC GGGGATCAATAGAGGGGGAAATA 512 ATPase6 AATTACCCCCATACTCCTTACACT GGGTCATGGGCTGGGTTTTACTAT ... GGGTCATGGGCTGGGTTTTACTAT 857 COX-I CCTCGGAGCTGGTAAAAA GGGGGTTCGATTCCTTC 1654 COX-II ACTACCCCGATGCATACACCACA GGGCAATGAATGAAGCGAACAG 1333 COX-III GCCGTACGCCTAACCGCTAACA TCGTAAGGGGTGGTTTTTCTATG 1177 Cyt b CGCACGGACTACAACCACGAC ... (Shanghai Shenkai Gas Co., Ltd. China), anti-CagA and anti-VacA polyclonal antibodies (Santa Cruz, USA), AP conjugate d sec-ondary antibody, CellTiter-Glo luminescent cell via-bility assay...
- 12
- 557
- 2
Báo cáo y học: "Maitake Mushroom Extracts Ameliorate Progressive Hypertension and Other Chronic Metabolic Perturbations in Aging Female Rats"
... synthetic tri-peptide substrate N-[3-(2-furyl)acryloyl] phenylalanylglcylglcine (FAPGG). FAPGG is hydro-lyzed by ACE to furylacryloylphenylalanine (FAP) and glycylglycine. Hydrolysis of FAPGG ... [8-13]. As a secondary gain, the influences of SX and D on the renin-angiotensin system (RAS), insulin sensitivity, and inflammation were also examined. MATERIAL AND METHODS Protocol: The Animal ... diet and water until SBP and the other cardi-ovascular readings were obtained after a slight warming between 13.00 h and 17.00 h. Multiple readings on individual rats at each reading were tak-en....
- 12
- 468
- 0
Báo cáo y học: "Percutaneous laser disc decompression for thoracic disc disease: report of 10 cases"
... neodymium:ytrium-aluminum garnet laser [Nd:YAG], holmium:ytrium- aluminum-garnet laser [Ho:YAG], and diode laser. Lasers with visible green radiation include double-frequency Nd:YAG laser and potassium-titanyl-phosphate ... herniation causing neural impingement is less common than that in the cervical or lumbar regions. Certain impact injuries, such as parachute landings, can result in thoracic disc damage. Invasive ... mid-thoracic axial (n=7) or radicular (n=1) pain that failed to improve with conservative management, which included typ-ical modalities such as physical therapy, pain medi-cation, and epidural...
- 5
- 593
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam