0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " A cluster randomized controlled trial aimed at implementation of local quality improvement collaboratives to improve prescribing and test ordering performance of general practitioners: Study Protocol" docx

báo cáo khoa học:

báo cáo khoa học: " A cluster randomized controlled trial aimed at implementation of local quality improvement collaboratives to improve prescribing and test ordering performance of general practitioners: Study Protocol" docx

... randomized controlled trial aimed at implementation of local quality improvement collaboratives to improve prescribing and test ordering performance of general practitioners: Study ProtocolJasper ... format. This format isbased on rational criteria for laboratory test registration to facilitate the integration of the individual databases intoone main database. All datasets on diagnostics will ... the various databases availa-ble at the participating hospital laboratories or primarycare diagnostic centres. Each centre will receive a data factsheet prescribing the required data format....
  • 14
  • 1,035
  • 0
báo cáo khoa học:

báo cáo khoa học: " A cluster randomized controlled trial comparing three methods of disseminating practice guidelines for children with croup [ISRCTN73394937]" pptx

... Alberta Ambulatory Care ClassificationSystem, the Alberta Health Care Insurance Plan (AHCIP)Payment Database, and the AHCIP Registry Dataset.All children 0–6 years of age and 6–16 years of age ... criteriaHealth care utilization using administrative databasesAlberta Health and Wellness, a branch of the Alberta pro-vincial government, is the custodian of several datasources that are accessible ... in March, 2004.Duration of the baseline and follow-up periodsUtilization and adverse outcome data obtained from the administrative datasetsWe have extracted data from administrative databasesfrom...
  • 13
  • 287
  • 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... forcortical actin-patch polarization? What is the rela-tionship among cortical actin-patch polarization,endocytosis, and growth at elevated temperatures?Here we address these questions and show that ... localizes to cortical pat-ches that display a subcellular distribution polarizedtowards sites of surface growth and partially colocaliz-es with cortical actin patches. Vrp1p localization to cortical ... growth at elevated temperature To delineate the domains of C-Vrp1p364)817(Fig. 1)responsible for restoration of endocytosis, growth at elevated temperatures, and full cortical actin-patchpolarization...
  • 23
  • 679
  • 0
Báo cáo khoa học: Alternative binding proteins: Anticalins – harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding activities pdf

Báo cáo khoa học: Alternative binding proteins: Anticalins – harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding activities pdf

... complexbetween a cognate anticalin and the extracellulardomain of CTLA-4 was solved, demonstrating that a macromolecular ‘protein antigen’ can be effectivelybound at the cup-shaped binding site of an engineeredlipocalin, ... further were made in a combinatorial approachusing a ‘loop-walking’ randomization strategy [12] and also by rational protein design based on the crystalstructure of this engineered lipocalin [23]. ... aswell as neoangiogenesis.Another promising drug candidate is an anticalinwith strong antagonistic activity towards VEGF.VEGF is a well-characterized mediator of tumorangiogenesis and other...
  • 7
  • 404
  • 0
Báo cáo khoa học nông nghiệp

Báo cáo khoa học nông nghiệp " Achievements and lesson learnt from implementation of the project "Sustainable community-based forest development and management in some high-poverty areas in Bac Kan Province" " pot

... planning and land allocation to facilitate land distribution and address the sustainable management of the forest. The project Goal is Sustainable improvement in livelihood security of disadvantaged ... disasters happen in local areas. In addition, the implementation of CFM plan creates the equality and solidarity in the communities. Table 09. Impacts and changes due to application of CFM plan [5] ... CFM plan at the village level, and (2) a CFM plan which describes and lists the activities that will be undertaken. Both the regulations and plans are a result of separate village meetings and...
  • 10
  • 334
  • 0
báo cáo khoa học:

báo cáo khoa học: "Improved delivery of cardiovascular care (IDOCC) through outreach facilitation: study protocol and implementation details of a cluster randomized controlled trial in primary care" doc

... willconsist of analysis of both quantitati ve data and qualita-tive data.Quantitative analysisDescriptive statistics will be generated for all project vari-ables (means and standard deviations ... practiceoutreach facilitation trial in Canada to date. It builds onprevious research in practice facilitation and attempts to translate research evide nce into practice in the impor-tant area of CVD management. ... standard forcollecting medical data as direct observation is prohibi-tively expensive and not feasible for a trial this large and administrative data are generally less reliable than chartdata...
  • 14
  • 415
  • 0
báo cáo khoa học:

báo cáo khoa học: "Design, rationale, and baseline characteristics of a cluster randomized controlled trial of pay for performance for hypertension treatment: study protocol" ppt

... Pressure), and widespread comparativeeffectiveness trials such as the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT) [ 4], translation into clinical practicehas ... hypertensive patients randomized to doxazosin vs chlorthalidone: the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT). JAMA2000, 283:1967-1975.5. Cabana MD, Rand CS, ... Donner A, Klar N: Design and Analysis of Cluster Randomization Trials inHealth Research London: Arnold; 2000.13. Kuhn M: Quality in primary care: economic approaches to analyzing quality- related...
  • 12
  • 353
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) 2913–2926 ª 2011 The Authors Journal compilation ª 2011...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... Foster City, CA, USA).Expression and purification of recombinantproteinSense (5¢-ATTTCATATGCAACAACAATTCCCCCAGCAACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCATAGGCCACTGATACTTATAACGTCGCTCCC-3¢) ... x-5 gliadin gene, oligonucleo-tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGATG-3¢, were constructed based on fragment DNA sequences of the x-5 gliadin gene ... (Takara Bio Inc.,Shiga, Japan). PCR was performed using KOD DNA polym-erase (Toyobo, Osaka, Japan) and DNA AMPLIFIERMIR-D40 (Sanyo, Osaka, Japan). To amplify the DNA frag-ments containing a...
  • 8
  • 484
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

... terms of training set size. We want to remind the reader thatour two algorithms are aimed at small datasets.We randomly split each dataset into 10 subsetswhere each subset was a test set and ... the ratio of 9:1 we randomly splitthe data into training, validation and test sets withthe ratio of 8:1:1. We then run our experiments and measured contingency table counts.Rather than placing ... U.K.spiegler@cs.bris.ac.ukPeter A. FlachIntelligent Systems Laboratory,University of Bristol, U.K.peter.flach@bristol.ac.ukAbstractThis paper demonstrates that the use of ensemble methods and carefully calibrat-ing...
  • 9
  • 557
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM