báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''''''TRY-ME''''''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pdf
... Program
OHIP – Ontario Health Insurance Plan
OPEM – Ontario Printed Educational Material
PEM – Printed Educational Material
TACT – Target, Action, Context, Time
TPB – Theory of Planned Behaviour
Competing ... for citation purposes)
Implementation Science
Open Access
Study protocol
Testing a TheoRY-inspired MEssage ('TRY-ME'): a sub-trial within
the Ontar...
... purposes)
Implementation Science
Open Access
Study protocol
Testing a TheoRY-inspired MEssage ('TRY-ME'): a sub-trial within
the Ontario Printed Educational Message (OPEM) trial
Jillian J Francis*
1
, ... Program
OHIP – Ontario Health Insurance Plan
OPEM – Ontario Printed Educational Material
PEM – Printed Educational Material
TACT – Target, A...
... pro-inflam-
matory mediators is probably a result of the fact that
inflammatory transcription factors such as nuclear
factor-kappaB, activator protein-1 and nuclear factor
of activated T-cells are ... Italy
Therapeutic strategies aimed at reducing brain dam-
age after ischemic stroke have been a major focus of
academic and industrial research for the past
30 years. Two primary therapeut...
... release of adenine-lack-
ing cobalamins, such as CN-Cbl and damaged cofac-
tor. The fact that the relative efficiencies of metal ions
for the reactivation are not always correlated with the
ATPase ... of the reactivase also suggested that the
interactions between the reactivase a and b subunits
are weakened at least partially by the ADP binding
[25]. The space that is opene...
... agitation at
200 rpm unless otherwise stated.
Enzymatic activity assay and characterization
The assay for hydantoinase activity was performed at 40 °C
with constant shaking. The reaction mixture contained
50 ... into the molecular basis of enzyme thermosta-
bility. J Bacteriol 185, 4038–4049.
20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka
Y & Takahashi S (1997) Process for produc...
... cellu-
lar networks allows the simplification of the set of
equations by assuming a steady state of the intra-
cellular metabolites. An approach that combines flux
balance analysis (FBA) with an ordinary ... adenylate
cyclase (CyaA) and leads to an increase in the intra-
cellular cyclic AMP (cAMP) level [1].
Mathematical models of catabolite
repression in E. coli
The (isolated) reac...
... template
using Deep Vent DNA polymerase (New England Biolabs,
Ipswich, MA, USA), a sense primer (CATATGGCTAGC
ATGCGCATATTGCTGAGTAAC) containing an NheI site
and an antisense primer (TTAGGATCCTTACCATTGCG
TGCCAACTCCCAC) ... S, Khachatr-
yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A,
Joachimiak A et al. (2001) Structure of Thermotoga
maritima stationary phase survival protein SurE: a...