báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''''''TRY-ME''''''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pdf

báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''TRY-ME''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pps

báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''TRY-ME''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pps

... Program OHIP – Ontario Health Insurance Plan OPEM – Ontario Printed Educational Material PEM – Printed Educational Material TACT – Target, Action, Context, Time TPB – Theory of Planned Behaviour Competing ... for citation purposes) Implementation Science Open Access Study protocol Testing a TheoRY-inspired MEssage ('TRY-ME'): a sub-trial within the Ontar...
Ngày tải lên : 11/08/2014, 05:22
  • 8
  • 126
  • 0
báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''TRY-ME''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pdf

báo cáo khoa học: " Testing a TheoRY-inspired MEssage (''''TRY-ME''''): a sub-trial within the Ontario Printed Educational Message (OPEM) trial" pdf

... purposes) Implementation Science Open Access Study protocol Testing a TheoRY-inspired MEssage ('TRY-ME'): a sub-trial within the Ontario Printed Educational Message (OPEM) trial Jillian J Francis* 1 , ... Program OHIP – Ontario Health Insurance Plan OPEM – Ontario Printed Educational Material PEM – Printed Educational Material TACT – Target, A...
Ngày tải lên : 11/08/2014, 16:20
  • 8
  • 163
  • 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

... pro-inflam- matory mediators is probably a result of the fact that inflammatory transcription factors such as nuclear factor-kappaB, activator protein-1 and nuclear factor of activated T-cells are ... Italy Therapeutic strategies aimed at reducing brain dam- age after ischemic stroke have been a major focus of academic and industrial research for the past 30 years. Two primary therapeut...
Ngày tải lên : 07/03/2014, 03:20
  • 10
  • 417
  • 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... of dopamine and a- synuclein interplay in a cellular model of Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna ... kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12, annexin A2 , annexin A5 , aldolase A, fascin 1 and peroxy...
Ngày tải lên : 15/02/2014, 01:20
  • 11
  • 775
  • 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... release of adenine-lack- ing cobalamins, such as CN-Cbl and damaged cofac- tor. The fact that the relative efficiencies of metal ions for the reactivation are not always correlated with the ATPase ... of the reactivase also suggested that the interactions between the reactivase a and b subunits are weakened at least partially by the ADP binding [25]. The space that is opene...
Ngày tải lên : 15/02/2014, 01:20
  • 13
  • 620
  • 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... agitation at 200 rpm unless otherwise stated. Enzymatic activity assay and characterization The assay for hydantoinase activity was performed at 40 °C with constant shaking. The reaction mixture contained 50 ... into the molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for produc...
Ngày tải lên : 18/02/2014, 08:20
  • 14
  • 621
  • 0
Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx

Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx

... cellu- lar networks allows the simplification of the set of equations by assuming a steady state of the intra- cellular metabolites. An approach that combines flux balance analysis (FBA) with an ordinary ... adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolated) reac...
Ngày tải lên : 18/02/2014, 13:20
  • 9
  • 723
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a...
Ngày tải lên : 18/02/2014, 14:20
  • 10
  • 553
  • 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R) 12 reverse CAAGGAGCGTTAGAATCTAAAG H1R 13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R) 14 reverse GATTTAAGTGGAGCGGAATGCTA ... both outer reverse ACGAAACCTGGCAGAGTCCAAG B6R 5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R 3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R 7 both forward CAGAAAAAGACAAGGAGGAC F19R Isoform-sp...
Ngày tải lên : 19/02/2014, 02:20
  • 11
  • 662
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG pGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAA...
Ngày tải lên : 19/02/2014, 05:20
  • 14
  • 517
  • 0

Xem thêm

Từ khóa: