báo cáo khoa học: " A social marketing approach to implementing evidence-based practice in VHA QUERI: the TIDES depression collaborative care model" pdf
... Association for Computational Linguistics, pages 912–920,
Jeju, Republic of Korea, 8-14 July 2012.
c
2012 Association for Computational Linguistics
A Ranking-based Approach to Word Reordering
for Statistical ... the paper.
2 Word Reordering as Syntax Tree Node
Ranking
Given a source side parse tree T
e
, the task of word
reordering is to transform T
e
to T
e
,...
... Czech Republic, June 2007.
c
2007 Association for Computational Linguistics
A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging
∗
Sharon Goldwater
Department of Linguistics
Stanford ... parameters.
We show using part-of-speech tagging that
a fully Bayesian approach can greatly im-
prove performance. Rather than estimating
a single set of parameters, the Baye...
... 73–76,
Prague, June 2007.
c
2007 Association for Computational Linguistics
A Feature Based Approach to Leveraging Context for Classifying
Newsgroup Style Discussion Segments
Yi-Chia Wang, Mahesh ... that context is to
enable the quality and nature of discussions that
occur within an on-line discussion board to be
communicated in a summary to a potential...
... learned sub-word models to guide
its hypotheses on phone boundaries.
Bayesian Model for Segmentation Our model is
inspired by previous applications of nonparametric
Bayesian models to segmentation ... supervision, our model captures and
learns the acoustic characteristics of a language au-
tomatically and is able to produce an acoustic model
that outperforms a language...
... Republic of Korea, 8-14 July 2012.
c
2012 Association for Computational Linguistics
A Two-step Approach to Sentence Compression of Spoken Utterances
Dong Wang, Xian Qian, Yang Liu
The University of ... effect of different compression meth-
ods on a meeting summarization task, but did not
evaluate sentence compression itself.
We propose to use a two-step approac...
... Syntax-Free Approach to Japanese Sentence Compression
Tsutomu HIRAO, Jun SUZUKI and Hideki ISOZAKI
NTT Communication Science Laboratories, NTT Corp.
2-4 Hikaridai, Seika-cho, Soraku-gun, Kyoto ... presented the compressed sentences to six
human subjects and asked them to evaluate the
sentence for fluency and importance on a scale 1
(worst) to 5 (best). For each source senten...
... written question-
factoid template pairs, which are applied on the
different sources to yield simple natural language
question- factoid pairs. Consider, for example, the
following two factoid -question ... in Section 3.1 to generate
training cases for all QA pairs in the three corpora.
To help our model learn that it is desirable to copy
answer words into the question, we add...
... A multi-staged approach to identifying
complex events in textual data
Conrad Chang, Lisa Ferro, John Gibson, Janet Hitzeman, Suzi Lubar, Justin Palmer,
Sean Munson, Marc Vilain, and Benjamin ... understood as relations
(job title) or events (acquisitions).
3.3 Statistical training
Because we had no existing methods to address
financial events or relations, we took this o...
... in dealing
with serial verb construction in CCG in Đ 3. I de-
scribe the hybrid model of CCG and the ller-gap
memory in Đ4. I then discuss the margin of gener-
ative power introduced by the memory ... SVCs: the
series of V
1
to V
3
and the series of V
4
to V
5
, be-
cause they do not share their tenses. The direc-
tional verb ‘go’ performs as an adver...
... importance evaluation. It is
constituted by production rules, called importance
rules, having the usual IF-THEN form. Rules can be
245
A RULE-BASED APPROACH TO EVALUATING IMPORTANCE IN DESCRIPTIVE ... relative importance
values to the different parts of a text and can
resolve or explain conflicting evaluations seems
more appropriate. Such an approach allows tak...
...
Many words in chat text are anomalous to natural
language. Chat text comprises of ill-edited terms
and anomalous writing styles. We refer chat
terms to the anomalous words in chat text. The
dynamic ... Dynamic Chinese Chat Text. EACL’06
NEW TEXT workshop, pp.48-55.
Xia, Y., K F. Wong and W. Li. 2006b. Constructing
A Chinese Chat Text Corpus with A Two-Sta...
... acronyms.
Assuming terms appearing frequently in
the proximity of an acronym to be
the expanded forms (definitions) of the
acronyms, we apply a term recognition
method to enumerate such candidates and
to measure ... disambiguated.
Thus, discovering acronyms and relating them
to their expanded forms is important for terminol-
ogy management. In this paper, we present a term
rec...
... receiving the TIDES marketing materials,
whether they felt the materials were compelling, and
whether they are referring patients to TIDES depression
care managers.
Discussion
Collaborative depression ... about the challenges and
benefits of implementing TIDES.
Frontline providers
The TIDES collaborative care model can only succeed if
frontline providers in...
... ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA
B genome ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA
D genome ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA
A
B
A ... ATTTACCCGCAGGTAAATTTAAAGCTTTA...