báo cáo khoa học: " A social marketing approach to implementing evidence-based practice in VHA QUERI: the TIDES depression collaborative care model" pdf

Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc

Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc

... Association for Computational Linguistics, pages 912–920, Jeju, Republic of Korea, 8-14 July 2012. c 2012 Association for Computational Linguistics A Ranking-based Approach to Word Reordering for Statistical ... the paper. 2 Word Reordering as Syntax Tree Node Ranking Given a source side parse tree T e , the task of word reordering is to transform T e to T  e ,...
Ngày tải lên : 19/02/2014, 19:20
  • 9
  • 615
  • 0
Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx

Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx

... Czech Republic, June 2007. c 2007 Association for Computational Linguistics A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging ∗ Sharon Goldwater Department of Linguistics Stanford ... parameters. We show using part-of-speech tagging that a fully Bayesian approach can greatly im- prove performance. Rather than estimating a single set of parameters, the Baye...
Ngày tải lên : 20/02/2014, 12:20
  • 8
  • 523
  • 0
Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx

Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx

... 73–76, Prague, June 2007. c 2007 Association for Computational Linguistics A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments Yi-Chia Wang, Mahesh ... that context is to enable the quality and nature of discussions that occur within an on-line discussion board to be communicated in a summary to a potential...
Ngày tải lên : 20/02/2014, 12:20
  • 4
  • 518
  • 0
Báo cáo khoa học: "A Nonparametric Bayesian Approach to Acoustic Model Discovery" docx

Báo cáo khoa học: "A Nonparametric Bayesian Approach to Acoustic Model Discovery" docx

... learned sub-word models to guide its hypotheses on phone boundaries. Bayesian Model for Segmentation Our model is inspired by previous applications of nonparametric Bayesian models to segmentation ... supervision, our model captures and learns the acoustic characteristics of a language au- tomatically and is able to produce an acoustic model that outperforms a language...
Ngày tải lên : 07/03/2014, 18:20
  • 10
  • 477
  • 0
Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf

Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf

... Republic of Korea, 8-14 July 2012. c 2012 Association for Computational Linguistics A Two-step Approach to Sentence Compression of Spoken Utterances Dong Wang, Xian Qian, Yang Liu The University of ... effect of different compression meth- ods on a meeting summarization task, but did not evaluate sentence compression itself. We propose to use a two-step approac...
Ngày tải lên : 07/03/2014, 18:20
  • 5
  • 425
  • 1
Báo cáo khoa học: "A Syntax-Free Approach to Japanese Sentence Compression" potx

Báo cáo khoa học: "A Syntax-Free Approach to Japanese Sentence Compression" potx

... Syntax-Free Approach to Japanese Sentence Compression Tsutomu HIRAO, Jun SUZUKI and Hideki ISOZAKI NTT Communication Science Laboratories, NTT Corp. 2-4 Hikaridai, Seika-cho, Soraku-gun, Kyoto ... presented the compressed sentences to six human subjects and asked them to evaluate the sentence for fluency and importance on a scale 1 (worst) to 5 (best). For each source senten...
Ngày tải lên : 08/03/2014, 00:20
  • 8
  • 464
  • 0
Báo cáo khoa học: "A Noisy-Channel Approach to Question Answering" docx

Báo cáo khoa học: "A Noisy-Channel Approach to Question Answering" docx

... written question- factoid template pairs, which are applied on the different sources to yield simple natural language question- factoid pairs. Consider, for example, the following two factoid -question ... in Section 3.1 to generate training cases for all QA pairs in the three corpora. To help our model learn that it is desirable to copy answer words into the question, we add...
Ngày tải lên : 08/03/2014, 04:22
  • 8
  • 393
  • 0
Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt

Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt

... A multi-staged approach to identifying complex events in textual data Conrad Chang, Lisa Ferro, John Gibson, Janet Hitzeman, Suzi Lubar, Justin Palmer, Sean Munson, Marc Vilain, and Benjamin ... understood as relations (job title) or events (acquisitions). 3.3 Statistical training Because we had no existing methods to address financial events or relations, we took this o...
Ngày tải lên : 08/03/2014, 21:20
  • 4
  • 404
  • 0
Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf

Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf

... in dealing with serial verb construction in CCG in Đ 3. I de- scribe the hybrid model of CCG and the ller-gap memory in Đ4. I then discuss the margin of gener- ative power introduced by the memory ... SVCs: the series of V 1 to V 3 and the series of V 4 to V 5 , be- cause they do not share their tenses. The direc- tional verb ‘go’ performs as an adver...
Ngày tải lên : 08/03/2014, 21:20
  • 9
  • 572
  • 0
Báo cáo khoa học: "A RULE-BASED APPROACH TO EVALUATING IMPORTANCE IN DESCRIPTIVE TEXTS" pptx

Báo cáo khoa học: "A RULE-BASED APPROACH TO EVALUATING IMPORTANCE IN DESCRIPTIVE TEXTS" pptx

... importance evaluation. It is constituted by production rules, called importance rules, having the usual IF-THEN form. Rules can be 245 A RULE-BASED APPROACH TO EVALUATING IMPORTANCE IN DESCRIPTIVE ... relative importance values to the different parts of a text and can resolve or explain conflicting evaluations seems more appropriate. Such an approach allows tak...
Ngày tải lên : 09/03/2014, 01:20
  • 7
  • 413
  • 0
Báo cáo khoa học: "A Phonetic-Based Approach to Chinese Chat Text Normalization" ppt

Báo cáo khoa học: "A Phonetic-Based Approach to Chinese Chat Text Normalization" ppt

... Many words in chat text are anomalous to natural language. Chat text comprises of ill-edited terms and anomalous writing styles. We refer chat terms to the anomalous words in chat text. The dynamic ... Dynamic Chinese Chat Text. EACL’06 NEW TEXT workshop, pp.48-55. Xia, Y., K F. Wong and W. Li. 2006b. Constructing A Chinese Chat Text Corpus with A Two-Sta...
Ngày tải lên : 17/03/2014, 04:20
  • 8
  • 425
  • 0
Báo cáo khoa học: "A Term Recognition Approach to Acronym Recognition" pot

Báo cáo khoa học: "A Term Recognition Approach to Acronym Recognition" pot

... acronyms. Assuming terms appearing frequently in the proximity of an acronym to be the expanded forms (definitions) of the acronyms, we apply a term recognition method to enumerate such candidates and to measure ... disambiguated. Thus, discovering acronyms and relating them to their expanded forms is important for terminol- ogy management. In this paper, we present a term rec...
Ngày tải lên : 17/03/2014, 04:20
  • 8
  • 341
  • 0
Báo cáo y học: "A social marketing approach to implementing evidence-based practice in VHA QUERI: the TIDES depression collaborative care model" docx

Báo cáo y học: "A social marketing approach to implementing evidence-based practice in VHA QUERI: the TIDES depression collaborative care model" docx

... receiving the TIDES marketing materials, whether they felt the materials were compelling, and whether they are referring patients to TIDES depression care managers. Discussion Collaborative depression ... about the challenges and benefits of implementing TIDES. Frontline providers The TIDES collaborative care model can only succeed if frontline providers in...
Ngày tải lên : 11/08/2014, 05:21
  • 12
  • 354
  • 0
báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

... ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA B genome ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA D genome ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA A B A ... ATTTACCCGCAGGTAAATTTAAAGCTTTA...
Ngày tải lên : 12/08/2014, 03:21
  • 14
  • 324
  • 0

Xem thêm

Từ khóa: