báo cáo khoa học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pot

báo cáo khoa học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pot

báo cáo khoa học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pot

... and knowledge about mentorship as a strategy to foster KT research and practice. Administrators responsible for planning, implementing, and evaluating mentoring pro- grams for research, education, career ... universities, research institutes, funding agencies, and professional organizations in Canada and elsewhere to develop, implement, and evaluate mentors...
Ngày tải lên : 11/08/2014, 16:20
  • 8
  • 317
  • 0
Báo cáo y học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pps

Báo cáo y học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pps

... 8 (page number not for citation purposes) Implementation Science Open Access Study protocol Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: ... Toronto, Toronto, Canada, 8 Emergency Medicine and Critical Care, St. Michael's Hospital, Toronto, Canada and 9 General Internal Medicine, St. Michael&ap...
Ngày tải lên : 11/08/2014, 05:21
  • 8
  • 592
  • 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

... virion surface Lyudmila A. Baratova 1 , Nataliya V. Fedorova 1 , Eugenie N. Dobrov 1 , Elena V. Lukashina 1 , Andrey N. Kharlanov 2 , Vitaly V. Nasonov 3 , Marina V. Serebryakova 4 , Stanislav V. ... In peak 2 (again for both viruses), a more complex picture was observed. Some material had the same mass as in peak 1, but there was also material with a molecular mass that differed fro...
Ngày tải lên : 23/03/2014, 13:20
  • 10
  • 398
  • 0
báo cáo khoa học: "Giant right coronary artery aneurysm presenting with non-ST elevation myocardial infarction and severe mitral regurgitation: a case report" ppsx

báo cáo khoa học: "Giant right coronary artery aneurysm presenting with non-ST elevation myocardial infarction and severe mitral regurgitation: a case report" ppsx

... of a rare dis- ease process. We put forward this case and the asso- ciated literature review a s an example of how a gia nt coronary artery aneurysm was managed at our hospital in the hope that ... of the aneurysm and mitral valve annuloplasty. Median sternotomy was performed with subsequent pericardiotomy. The conduits (left internal mammary artery, left radial artery and right r...
Ngày tải lên : 10/08/2014, 23:20
  • 4
  • 113
  • 0
Báo cáo khoa học: "Vasopressin improves outcome in out-of-hospital cardiopulmonary resuscitation of ventricular fibrillation and pulseless ventricular tachycardia: a observational cohort study" ppsx

Báo cáo khoa học: "Vasopressin improves outcome in out-of-hospital cardiopulmonary resuscitation of ventricular fibrillation and pulseless ventricular tachycardia: a observational cohort study" ppsx

... system for classification of cardiac death as arrhythmic, ischemic or due myocardial pump failure. Am J Cardiol 1995, 76:896-898. 30. Jacobs I, Nadkarni V, ILCOR Task Force on cardiac Arrest and Cardiopulmonary ... Guidelines and in the Emer- gency Cardiovascular Care Guidelines 2000 for Cardiopul- monary Resuscitation and Emergency Cardiovascular Care, vasopressin is considered...
Ngày tải lên : 12/08/2014, 23:21
  • 7
  • 248
  • 0
báo cáo khoa học: "Process evaluation of appreciative inquiry to translate pain management evidence into pediatric nursing practice" ppt

báo cáo khoa học: "Process evaluation of appreciative inquiry to translate pain management evidence into pediatric nursing practice" ppt

... qualitative analysis consequent to the role of the lead author as a facilitator of the AI sessions. A reflexive journal was maintained to capture assumptions, and, although the lead author was ... Qualitative, Quantitative, and Mixed Methods Approaches. 3 edition. Thousand Oaks: Sage Publications; 2009. 24. Corbin J, Strauss A: Basics of Qualitative Research Thousand Oak...
Ngày tải lên : 10/08/2014, 10:23
  • 13
  • 281
  • 0
Báo cáo khoa học: "Drotrecogin alfa (activated) should not be used in patients with severe sepsis and low risk for death" pdf

Báo cáo khoa học: "Drotrecogin alfa (activated) should not be used in patients with severe sepsis and low risk for death" pdf

... by an Acute Physiology and Chronic Health Evaluation (APACHE II) score ≥ 25 or multiorgan failure. As a condition for approval, the manufacturer, Eli Lilly and Company, agreed to complete a ... Drotrecogin Alfa (Activated) in Early Stage Severe Sepsis (ADDRESS) study [1], Abraham and colleagues assessed the role of DrotAA in patients with severe sepsis and low risk of...
Ngày tải lên : 13/08/2014, 03:20
  • 3
  • 295
  • 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... S, Asano N & Suzuki Y (1999) Acceler- ated transport and maturation of lysosomal alpha-galac- tosidase A in Fabry lymphoblasts by an enzyme inhibitor. Nat Med 5, 112–115. 20 Fan J-Q & ... cardiac function in the cardiac variant of Fabry’s disease with galactose-infusion therapy. N Engl J Med 345, 25–32. 18 Asano N, Ishii S, Kizu H, Ikeda K, Yasuda K, Kato A, Martin OR & Fan...
Ngày tải lên : 18/02/2014, 16:20
  • 7
  • 507
  • 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... recovered differentially based on varying stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis ... the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy chain an...
Ngày tải lên : 19/02/2014, 12:20
  • 7
  • 502
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting ... (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5...
Ngày tải lên : 19/02/2014, 17:20
  • 12
  • 616
  • 0

Xem thêm

Từ khóa: