báo cáo khoa học: " Exploring mentorship as a strategy to build capacity for knowledge translation research and practice: protocol for a qualitative study" pot
... and
knowledge about mentorship as a strategy to foster KT
research and practice. Administrators responsible for
planning, implementing, and evaluating mentoring pro-
grams for research, education, career ... universities, research institutes, funding agencies, and
professional organizations in Canada and elsewhere to develop, implement, and evaluate
mentors...
... 8
(page number not for citation purposes)
Implementation Science
Open Access
Study protocol
Exploring mentorship as a strategy to build capacity for knowledge
translation research and practice: ... Toronto, Toronto, Canada,
8
Emergency Medicine and Critical Care, St. Michael's Hospital, Toronto, Canada and
9
General Internal
Medicine, St. Michael&ap...
... virion surface
Lyudmila A. Baratova
1
, Nataliya V. Fedorova
1
, Eugenie N. Dobrov
1
, Elena V. Lukashina
1
,
Andrey N. Kharlanov
2
, Vitaly V. Nasonov
3
, Marina V. Serebryakova
4
, Stanislav V. ... In peak 2 (again for both viruses), a more complex
picture was observed. Some material had the same mass as
in peak 1, but there was also material with a molecular mass
that differed fro...
... of a rare dis-
ease process. We put forward this case and the asso-
ciated literature review a s an example of how a gia nt
coronary artery aneurysm was managed at our hospital
in the hope that ... of
the aneurysm and mitral valve annuloplasty.
Median sternotomy was performed with subsequent
pericardiotomy. The conduits (left internal mammary
artery, left radial artery and right r...
... system for
classification of cardiac death as arrhythmic, ischemic or due
myocardial pump failure. Am J Cardiol 1995, 76:896-898.
30. Jacobs I, Nadkarni V, ILCOR Task Force on cardiac Arrest and
Cardiopulmonary ... Guidelines and in the Emer-
gency Cardiovascular Care Guidelines 2000 for Cardiopul-
monary Resuscitation and Emergency Cardiovascular Care,
vasopressin is considered...
... qualitative analysis consequent to the role of the
lead author as a facilitator of the AI sessions. A reflexive
journal was maintained to capture assumptions, and,
although the lead author was ... Qualitative, Quantitative, and Mixed Methods
Approaches. 3 edition. Thousand Oaks: Sage Publications; 2009.
24. Corbin J, Strauss A: Basics of Qualitative Research Thousand Oak...
... by an
Acute Physiology and Chronic Health Evaluation (APACHE
II) score ≥ 25 or multiorgan failure. As a condition for
approval, the manufacturer, Eli Lilly and Company, agreed
to complete a ... Drotrecogin Alfa (Activated) in Early
Stage Severe Sepsis (ADDRESS) study [1], Abraham and
colleagues assessed the role of DrotAA in patients with
severe sepsis and low risk of...
... S, Asano N & Suzuki Y (1999) Acceler-
ated transport and maturation of lysosomal alpha-galac-
tosidase A in Fabry lymphoblasts by an enzyme
inhibitor. Nat Med 5, 112–115.
20 Fan J-Q & ... cardiac function in the cardiac variant
of Fabry’s disease with galactose-infusion therapy. N
Engl J Med 345, 25–32.
18 Asano N, Ishii S, Kizu H, Ikeda K, Yasuda K, Kato A,
Martin OR & Fan...
... recovered
differentially based on varying stabilities. Remarkably, we
have found that, at least in some circumstances, a quanti-
tative correlation to biophysical data can be obtained from
a statistical analysis ... the association of the variable heavy chain (V
H
)with
protein A was used as a surrogate for direct stability
measurements. The V
H
domains in camelid heavy chain
an...
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) for amplification of pyk. The resulting ... (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4
(5...