0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " How is Telemedicine perceived? A qualitative study of perspectives from the UK and India" pps

báo cáo khoa học:

báo cáo khoa học: " How is Telemedicine perceived? A qualitative study of perspectives from the UK and India" pps

... RESEARCH Open Access How is Telemedicine perceived? A qualitative study of perspectives from the UK and IndiaMelisa Martínez Álvarez1*, Rupa Chanda2 and Richard D Smith1AbstractBackground: ... er the auspices of the World Trade Organisation), which is misplaced as a significant amount of trade takes place regionally orbi-laterally. We report here the results of a qualitative study assessing ... melisa.martinez-alvarez@lshtm.ac .uk 1Department of Global Health and Devel opment, London School of Hygiene and Tropical MedicineFull list of author information is available at the end of the...
  • 7
  • 338
  • 0
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

... material is availableonline:Fig. S1. MS analysis of mouse PCSK9-propeptide and mouse PCSK9-propeptide variants.This material is available as part of the online article from http://www.blackwell-synergy.com.Please ... immunoblotting from Imgenex (SanDiego, CA, USA). Secondary anti-mouse and anti- (rabbitHRP) IgG were from Amersham (Piscataway, NJ, USA) and the secondary anti-(goat HRP) IgG was from Santa CruzBiotechnology ... specificband just above the major propeptide band represents the propeptide generated by the alternate signal pepti-dase cleavage following Ala28 instead of Ala30, asshown in the mass spectra previously...
  • 14
  • 454
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Delineation in thoracic oncology: a prospective study of the effect of training on contour variability and dosimetric consequences" potx

... (NSCLC) was proposed, before and after a teaching course on radioanatomy and radiotherapy techniques of lung cancer irradiation. We evaluated the influence of the teaching course on the variability ... conformal indices (KI and OV) at the end of the course, i.e. the most divergent, was studied and a treatment plan was calculated for this group. This plan was then compared with the treatment plan ... delineated volume (ADV). Then, the kappa index (KI) and the overlap volume (OV) were calculated (Figure 2). The last step consisted of an analysis of variance between pre and post-course delineated...
  • 24
  • 376
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx

... this paper can be divided intwo parts: the aggregate analysis of Bulgarian di-alects on one hand, and the identification of linguis-tic structure in the aggregate analysis on the other. Inthis ... (2005) and Nerbonne (2006). In both of these papers the identification of linguistic structurein the aggregate analysis is based on the analysis of the pronunciation of the vowels found in the data ... was usedin order to make an aggregate analysis of Bulgariandialects. In this section more information on the dataset used in the project, as well as on the process of the aggregate analysis...
  • 6
  • 651
  • 0
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

... AAAGGTTTCCTCCACCCTGTAK-LR ACTTCCTCGAGCTTGTCACG 450CHH-SF GACTTGGAGCACGTGTGTCHH-SR TATTGGTCAAACTCGTCCAT 143MIH-SF AAGACAGGAATGGCGAGTMIH-SR AATCTCTCAGCTCTTCGGGAC 100AK-SF AAACGGTCACCCTCCTTGAAK-SR ACTTCCTCGAGCTTGTCACG ... hormone.Primername Sequence (5¢fi3¢)Productsize (bp)CHH-LF GCCATGCTAGCAATCATCACCGTAGCHH-LR GTTGAGATCTGTTGTTTACTTCTTC 423MIH-LF GAGTTATCAACGACGAGTGTCCMIH-LR GAGACGACAAGGCTCAGTCC 249AK-LF AAAGGTTTCCTCCACCCTGTAK-LR ... than at any othertime in the moult cycle. As quantities of CHH were quitevariable at different stages, ratios of CHH/MIH werecalculated for pairs of sinus glands. This analysis showedthat the...
  • 9
  • 587
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "STRING-TREE CORRESPONDENCE GRAMMAR: A DECLARATIVE GRAMMAR FORMALISM FOR DEFINING THE CORRESPONDENCE BETWEEN STRINGS OF TERMS AND TREE STRUCTURES" pdf

... York, August 1985. [Zaharin 86] Zaharin Y. "Strategies and heuristics in the analysis of a natural language in machine translation". PhD thesis, Universiti Sains Malaysia, Penang, ... only the grammar formalism ; a discussion on the linguistic approach can be found in [Vauquois 78] and [Zaharin 87]. For this grammar formalism, a structural representation is given in the ... the same tree (a paraphrase) by means of two different rules. We shall discard the alternative and adopt the first approach .The generalised rule ~l, ~n~8 (with each u. being the name of a...
  • 7
  • 444
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf

... of experimental evidence from a variety of knowledgebase linking and lexical disambiguation tasks (Nav-igli and Lapata, 2010; Ponzetto and Navigli, 2010).Next, these paths are stored within a Lucene ... or are automatictranslations (WNTR / WIKITR) – and about theirlanguage and lemma. In addition, translation rela-tions among lexical items are represented as a map-ping from source to target ... pointers and an additional sym-bol for Wikipedia relations (r), which can alsospecify the source of the relation (e.g., FROM ITmeans that the relation was harvested from the Ital-ian Wikipedia)....
  • 6
  • 400
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Opinion Mining Using Econometrics: A Case Study on Reputation Systems" pdf

... features affect product sales and extract the pragmatic meaning of these evaluations.Another application is the analysis of the effect of news stories on stock prices: we can examine whatnews ... transaction that takes place, we keep the price at which the product was sold and the mer-chant’s reputation at the time of the transaction (moreon this later). Additionally, for each of the ... and March 2005. We describebelow the two categories of data that we collected.Transaction Data: The first part of our data setcontains details of the transactions that took place on the marketplace...
  • 8
  • 440
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc

... Document rankingagainst a query is based on statistical correlationbetween query words and words in a document.Since a document is a small sample of text, the statistics in a document are often ... subset is called a cut of ;stands for the complement . Ifare disjoint cuts then is a set of edgeswithin cut ; is called weight of cut ; is a set of edges between cuts and ; is called weight of the ... documents. The texts were articles from two different newspapers and one journal. Eachdocument was morphologically analyzed and lem-matized (Hajiˇc, 2000) and then indexed and rep-resented as a vector....
  • 6
  • 447
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Unsupervised Relation Extraction by Mining Wikipedia Texts Using Information from the Web" pdf

... various relations and for measuring the quality of these relations in terms of precision and cover-age. We use coverage as an evaluation instead of using recall as a measure. The coverage is used ... of the dataset. After the ranking, we obtain a globalranked list of relational terms Tallfor the wholedataset (all the concept pairs). For each conceptpair, a local list of relational terms ... encyclopaedias go head tohead. Nature 438:900C901.Sanda Harabagiu, Cosmin Adrian Bejan and PaulMorarescu. 2005. Shallow semantics for relationextraction. In Proceedings of IJCAI-2005.Takaaki Hasegawa,...
  • 9
  • 345
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ