0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Healthy lifestyle behaviour among Ghanaian adults in the phase of a health policy change" pdf

báo cáo khoa học:

báo cáo khoa học: "Healthy lifestyle behaviour among Ghanaian adults in the phase of a health policy change" pdf

... 7:7http://www.globalizationandhealth.com/content/7/1/7Page 3 of 9RESEARCH Open AccessHealthy lifestyle behaviour among Ghanaian adults in the phase of a health policy changeHenry A Tagoe and Fidelia AA Dake*AbstractBackground: ... 4).DiscussionThis paper examined the trend in healthy lifestyle beha-viour among Ghanaian adults in the phase of the “Regenerative Health and Nutrition” health policy. Ourfindings reveal an increase in risky ... encouraging peop le toadopt healthy lifestyle behaviours. This paper examines healthy lifestyl e behaviour among Ghanaian adults bycomparing behaviours before and after the introduction of a national...
  • 9
  • 408
  • 0
báo cáo khoa học:

báo cáo khoa học: " Peritonitis secondary to traumatic duodenal laceration in the presence of a large pancreatic pseudocyst: a case report" ppsx

... sto-mach. His abdominal cavity was lavaged with copiouswarm saline, a drain placed adjacent to the gastrojeju-nostomy and a drain by the duodenal repair and hisabdomen closed. The drains were ... bluntabdominal trauma i n the presence of a large pancreaticpseudocyst. Minor blunt abdominal trauma in a normalhealthy adult would not be expected to result in any sig-nificant duodenal i ... our patient was found to be tachycardic,drowsy and in severe pain. Abdominal examinationrevealed a large firm epigastric mass. There was rightupper quadrant tenderness with guarding. He was...
  • 4
  • 251
  • 0
Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

... and materialsThis work was approved by The University of AdelaideAnimal Ethics Committee.Acetylcholine, atropine, concanavalin A, CCK-8 andCCK-8-NS were obtained from Sigma-Aldrich. Alamar ... Bioscience, The University of Queensland, Brisbane, Queensland, AustraliaMarsupials are born in an immature state and many of the developmental processes that occur in thesemammals take place during ... pro-cessing intermediates. Am J Physiol 252, G315–G319.39 Anastasi A, Erspamer V & Endean R (1968) Isolationand amino acid sequence of caerulein, the active peptide in the skin of Hyla caerulea....
  • 11
  • 638
  • 0
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

... perinuclear areas of the cell via its N-ter-minal ABD. In the absence of ligand, AR is localizedpredominantly in the cytoplasm, and its hinge domainand the LBD are tethered to the C-terminal end of FLNa ... transport of the AR, interacts with the AR DBD–LBD in a ligand-independent manner[77,86,87]. The absence of filamin hampers androgen-induced AR transactivation. In the absence of filamin, the ... a- actinin-2 (con-taining a LXXLL motif) and mutant a- actinin-2(mutation of the LXXLL motif to LXXAA) both bindto the AR, but the mutant form shows much weakerbinding than wild-type a- actinin-2....
  • 17
  • 573
  • 0
Báo cáo khoa học: Functionally distinct dopamine and octopamine transporters in the CNS of the cabbage looper moth* potx

Báo cáo khoa học: Functionally distinct dopamine and octopamine transporters in the CNS of the cabbage looper moth* potx

... insect; neurotransmitter; transporter; dopamine;octopamine; cocaine. The catecholamine dopamine (DA), the phenolamineoctopamine (OA) and the indolamine serotonin (5-HT) in uence a variety of ... within the range reported for cloned mammalianDATs), our data suggest that DA is the primary naturalsubstrate of TrnDAT and octopamine (and possiblytyramine) the natural substrate of TrnOAT ... blocker of dopamine uptake by mammalian DATs is a weak blocker of TrnDAT and other invertebrate DATs [11]. Cocaine is a powerful blocker of hDAT but apparently not of inver-tebrate DATs. Nomifensine,...
  • 11
  • 431
  • 0
Báo cáo khoa học: Upstream and intronic regulatory sequences interact in the activation of the glutamine synthetase promoter pot

Báo cáo khoa học: Upstream and intronic regulatory sequences interact in the activation of the glutamine synthetase promoter pot

... becalculated with an approach based on the analysis of variance (ANOVA) technique. To normalize the data, the activity of reference construct A was set to 100 arbitraryunits (AU) in these calculations. ... co-operative effects is that the binding of a factor to an element within such an array entails anincrease in the affinity of adjacent elements for theircorresponding transcription factors. ... [13].Co-operative interactions in the binding of transcriptionfactors to arrays of response elements within an enhancermodule appear to be the rule rather than the exception. The explanation for these...
  • 7
  • 401
  • 0
Báo cáo khoa học: Accessory proteins functioning selectively and pleiotropically in the biosynthesis of [NiFe] hydrogenases in Thiocapsa roseopersicina docx

Báo cáo khoa học: Accessory proteins functioning selectively and pleiotropically in the biosynthesis of [NiFe] hydrogenases in Thiocapsa roseopersicina docx

... (Table 3). The results indicate that the two relatedputative proteins cannot replace one another in the matur-ation of the various hydrogenases.DiscussionThiocapsa roseopersicina harbors at ... the maturation of functionally active hydro-genases in T. roseopersicina and to understand their physio-logical roles. The determination of the specificity of the accessory proteins is a challenging ... roseopersicina [19]. The genetic approach was devel-oped further for producing in- frame deletion mutants in thisstrain. Here we show the molecular characterization of the T. roseopersicina mutant strains,...
  • 10
  • 475
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Major liver resection for hepatocellular carcinoma in the morbidly obese: A proposed strategy to improve outcome" doc

... 204:22-33.25. Aoki T, Imamura H, Hasegawa K, Matsukura A, Sano K, Sugawara Y,Kokudo N, Makuuchi M: Sequential preoperative arterial andportal venous embolizations in patients with hepatocellularcarcinoma. ... segment IV of the leftlobe and segments V and VIII of the right lobe of the liver,partially occluding the proximal part of the common bileduct and causing moderate dilatation of the intrahepaticbiliary ... chemoradiation therapy, but therewas no evidence of microvascular invasion. In the normalliver parenchyma, there was evidence of postemboliza-tion effects, mainly focal areas of foreign body giant...
  • 5
  • 332
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf

... 262:13907-13915.37. Nakata K, Tanaka Y, Nakano T, Adachi T, Tanaka H, Kaminuma T,Ishikawa T: Nuclear receptor-mediated transcriptional regu-lation in Phase I, II, and III xenobiotic metabolizing systems.Drug ... 369:583-591.34. Kamiya A, Kinoshita T, Ito Y, Matsui T, Morikawa Y, Senba E,Nakashima K, Taga T, Yoshida K, Kishimoto T, Miyajima A: Fetalliver development requires a paracrine action of oncostatinM through ... apical staining of this marker wasapparent in distinct areas of 3-D Huh7 aggregates (Fig. 3).Taken together, these data demonstrate that the expres-sion and distribution of cell adhesion and TJ...
  • 8
  • 642
  • 0
Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

... (CAGGACAGCCTGCGCAACGAG), RVR (CAGGACAGGGTGCGCAACGAG), SVR (CAGGACAGCGTGCGCAACGAG) and SLC (AGGGTATCCCTCTGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... signal observed in all lanes loadedwith bacterial protein. The CYP 6A2 variants have the same apparentmolecularmassasCYP 6A2 fromD. melanogaster microsomes. The apoenzyme production varied among the ... located diametrically to the polecarrying the amino acids involved in substrate binding. Asfar as we know, there has been no report about structureactivity relationships in this area of the...
  • 8
  • 535
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam