0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Transformational leadership, transnational culture and political competence in globalizing health care services: a case study of Jordan''''''''s King Hussein Cancer Center" pps

báo cáo khoa học:

báo cáo khoa học: "Transformational leadership, transnational culture and political competence in globalizing health care services: a case study of Jordan''''s King Hussein Cancer Center" pps

... supporting patientinteraction in Arabic. Arabic was used as the primary lan-guage for patient, family, and local physician interactions;training and engagement with staff in the clinical setting; and ... 1 of 13(page number not for citation purposes)Globalization and Health Open AccessResearchTransformational leadership, transnational culture and political competence in globalizing health ... Model." A team of technical experts(U.S. and European-trained Arab region professionalswith credentials in all aspects of cancer care and hospitalmanagement) was recruited from within Jordan and...
  • 13
  • 417
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia (DIPNECH) in association with an adenocarcinoma: a case report" ppsx

... citation purposes)Journal of Medical Case ReportsOpen Access Case reportDiffuse idiopathic pulmonary neuroendocrine cell hyperplasia (DIPNECH) in association with an adenocarcinoma: a case ... reported a similar case in which DIPNECH was associated with a carcinoid [5].The current report represents the first case of a patient withDIPNECH accompanied by a pulmonary adenocarci-noma of mixed ... partial neuroendocrine dif-ferentiation. The adenocarcinoma was positive for typicalmarkers such as CK7, CK18, TTF1, and SPA and addition-ally, it was positive for NSE and CEA, which were alsomeasured...
  • 3
  • 356
  • 0
báo cáo khoa học:

báo cáo khoa học: " Improving outcomes for ill and injured children in emergency departments: protocol for a program in pediatric emergency medicine and knowledge translation science" potx

... Ottawa, Canada, 6Department of Statistics, University of British Columbia, Vancouver, Canada, 7Canadian Institutes of Health Research, Ottawa, Canada, 8Department of Family Medicine, Faculty ... University of Ottawa, Ottawa, Canada, 4Department of Pediatrics, Faculty of Medicine, University of Calgary, Calgary, Canada, 5Departments of Pediatric and Emergency Medicine, University of Ottawa, ... multidis-ciplinary and interdisciplinary. We believe that the opti-mal paradigm for increased and rapid uptake of researchevidence is a healthcare program which has embeddedwithin it clinical researchers...
  • 7
  • 231
  • 0
Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

... these amino acids and amino acid derivatives, and values of DGD°, measured in triplicate, are given in Table 1.The effect of polyols on the kinetic parameters (Km and kcat) of the RNase -A mediated ... R. Singh*,, Tanveer A. Dar*,à, Vikas Rishi§ and Faizan AhmadCentre for Interdisciplinary Research in Basic Sciences, Jamia Millia Islamia, New Delhi, IndiaIntroductionBoth prokaryotic and ... Tm(midpoint of denaturation) and DHm(enthalpy change atTm) using a nonlinear least squares analysis according tothe relationship described earlier (see equation (1) in [25]).Using a value of...
  • 9
  • 547
  • 0
Báo cáo khoa học: Structural origins for selectivity and specificity in an engineered bacterial repressor–inducer pair pdf

Báo cáo khoa học: Structural origins for selectivity and specificity in an engineered bacterial repressor–inducer pair pdf

... converged at an Rwork of 20.7% and an Rfreevalue of 26.1%. The ligand 4-ddma-atc and ligand restraints parameters were generated usingcorina [26]. The individual models were validated usingthe software ... previouslyavailable biochemical characterization, represent a challenging benchmark data set for testing and validat-ing computational models aimed at predicting and designing the specificity and selectivity ... ligandpositions of tetracycline, dox and atc in TetR, theseligands superimpose with an average rmsd of 0.26 A ˚for 27 common ligand atoms. In the case of the4-ddma-atc complex, the ligand appears to...
  • 12
  • 501
  • 0
Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot

Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot

... Zachary J. Kraus and Pamela L. SchwartzbergNational Human Genome Research Institute, National Institutes of Health, Bethesda, MD, USAIntroductionAmong the key players in intracellular signaling ... signaling, requiredfor full activation of phospholipase Cc, and downstream Ca2+ and ERK-mediated signaling pathways. Over the last 10 years, data have implicatedthe Tec family kinases Itk and ... domain, preceded by Srchomology 2 and -3 protein interaction domains that areimportant for kinase regulation, and a Tec homologydomain containing one or two proline-rich regions thatinteract...
  • 10
  • 312
  • 0
Báo cáo khoa học: Enhanced sensitivity to hydrogen peroxide-induced apoptosis in Evi1 transformed Rat1 fibroblasts due to repression of carbonic anhydrase III docx

Báo cáo khoa học: Enhanced sensitivity to hydrogen peroxide-induced apoptosis in Evi1 transformed Rat1 fibroblasts due to repression of carbonic anhydrase III docx

... knockdown of caIIImRNA and protein and enhanced caspase 3 catalyticactivity in Rat1 cells.Fig. S2. DsiRNA-mediated knockdown of caIIImRNA and protein and caspase 3 catalytic activity in Rat1 cells ... TAMRA rat caIII probe: cttcaccacgccaccctgcgag5¢ rat gapdh: gggcagcccagaacatca3¢ rat gapdh: ccgttcagctctgggatgac5¢ 6-FAM, 3¢ TAMRA rat gapdh probe: ccctgcatccactggtgctgccPreparation of total ... spsiRNAsiRNA 1UT750 µM*** A BCFig. 7. DsiRNA-mediated knockdown of caIII mRNA and protein and enhanced caspase 3 catalytic activity in Rat1 cells. (A) Histo-gram of caIII mRNA levels normalized...
  • 12
  • 446
  • 0
Báo cáo khoa học: Unchanged thymidine triphosphate pools and thymidine metabolism in two lines of thymidine kinase 2-mutated fibroblasts docx

Báo cáo khoa học: Unchanged thymidine triphosphate pools and thymidine metabolism in two lines of thymidine kinase 2-mutated fibroblasts docx

... metabolism in two lines of thymidinekinase 2-mutated fibroblastsMiriam Frangini1, Chiara Rampazzo1, Elisa Franzolin1, Mari-Carmen Lara2, Maya R. Vila`2,Ramon Martı´2 and Vera Bianchi11 ... min of incubation, thedTTP pool had reached a specific radioactivity of about 7000 c.p.m.Æpmol)1 in Ca and Pb cells, and about 5000 in Cb and Pa cells (Fig. 2B), indicatingthat one-third of ... dTTP of Ca and Pb cells and between one-quarter and one-fifth of the dTTP of Cb and Pa cells was derived from salvage of extracellularthymidine. BVDU decreased the specific radioactivity of dTTP after...
  • 10
  • 309
  • 0
Báo cáo khoa học nông nghiệp

Báo cáo khoa học nông nghiệp " Genetic materials and silvicultural techniques in plantation-grown acacias for sawn timber products " pot

... areas:9 A. auriculiformis: Centre and South 9 A. mangium: North9 A. crassicarpa: centre and south9 Acacia hybrid: North, Centre and South High land areas: A. mearnsii (Bodalla and Nowa ... techniques in plantation-grown acacias for sawn timber productsCollaboration in Agriculture and Rural Development Project VIE:032/05“Sustainable and profitable development of acacia plantations ... silvicultural techniques for sustainable acacia sawlog production through a scientifically designed and monitored establishment trial, and thinning and pruning trials in already-established plantations,...
  • 24
  • 326
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM