Báo cáo y học: "Duodenal enteroglucagonoma revealed by differential comparison of serum and tissue glucagon reactivity with Siemens'''''''' Double Glucagon Antibody and DakoCytomation''''''''s Polyclonal Rabbit Anti-Human Glucagon: a case report" ppsx
Báo cáo y học: "Duodenal enteroglucagonoma revealed by differential comparison of serum and tissue glucagon reactivity with Siemens'''' Double Glucagon Antibody and DakoCytomation''''s Polyclonal Rabbit Anti-Human Glucagon: a case report" ppsx
... this article as: Vanderlan et al., Duodenal enteroglucagonoma revealed by differential comparison of serum and tissue glucagon reactivity with Sie-mens' Double Glucagon Antibody and DakoCytomation's ... differential comparison of serum and tissue glucagon reactivity with Siemens' Double Glucagon Antibody and DakoCytomation's Polyclonal Rabbit Anti-Human Glucagon : a case reportWesley ... only indicated the level of pancreatic glucagon while tissue reactivity with Polyclonal Rabbit Anti-Human Glucagon reagent was capable of detectingboth pancreatic and enteral glucagon. To summarize,...
- 3
- 371
- 0
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
... recovery was une-ventful, and the patient was discharged on postoper-ative day 4. Fig.1 Fluid collection and left ovary cyst was noted on computed tomography. The size of ovary cyst was 2.0 ... of a monolayer of inner circular muscle, which makes its wall weak, as com-pared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers. The vasa ... 468 copy owing to incomplete bowel preparation. The bleeding was controlled by #3-0 Vycryl intracorporeal suture, and the invagination of the diverticulum was performed laparoscopically. The...
- 3
- 531
- 0
Báo cáo y học: "Persistent sciatica induced by quadratus femoris muscle tear and treated by surgical decompression: a case report" docx
... luteal area with radiati on to the proximalposterior thigh. Pain was aggravated by sitting and squatting. MRI examination at that time revealed anextensive hematoma extending to both the quadratusfemoris ... injury. The immediate and correct diagno-sis is a challeng e because of its rarity and similarities toother disorders that cause groin pain. Only a few cases of partial and complete rupture of ... treated by surgicaldecompression: a case reportArtan Bano1, Apostolos Karantanas2, Dritan Pasku1*, George Datseris3, George Tzanakakis4, Pavlos Katonis1AbstractIntroduction: Quadratus...
- 4
- 275
- 0
Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report" ppsx
... (elevated heart rate and arterialblood pressure ); exacerbation of anxiety; and activation of the hypothalamic-pituitary-adrenal axis. The mostfrequently reported side effects are arrhythmias,hyperthermia, ... 40(3):395-404.doi:10.1186/1752-1947-4-240Cite this article as: Gama et al.: Diabetic ketoacidosis complicated by the use of ecstasy: a case report. Journal of Medical Case Reports 20104:240.Gama et al. Journal of Medical Case Reports ... peritoneal irritation. H er temperature was 37.3°C and the chest X-ray was normal. Urine analysis showed pro-nounced ketonuria and an absence of pyuria; a urinarybacterioscopy did not reveal bacteria;...
- 3
- 399
- 0
Báo cáo y học: " Persistent sciatica induced by quadratus femoris muscle tear and treated by surgical decompression: a case report" ppt
... our case) with a female to maleratioof6:1.Theageofpatientsrangesfrom17to43years with an average a ge of 29.6 years. The symptomswere hip pain in three patients, gr oin pain in one pati ent and ... was obtained from the patientfor publication of this case report and any accompany-ing images. A copy of the written consent is availablefor review by the Editor-in-Chief of this journal.Author ... Histopathological examination of the removed massshowing a significant quantity of fibrotic tissue and atrophy of muscles bundles.Bano et al. Journal of Medical Case Reports 2010, 4:236http://www.jmedicalcasereports.com/content/4/1/236Page...
- 4
- 316
- 0
Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report." docx
... 40(3):395-404.doi:10.1186/1752-1947-4-240Cite this article as: Gama et al.: Diabetic ketoacidosis complicated by the use of ecstasy: a case report. Journal of Medical Case Reports 20104:240.Gama et al. Journal of Medical Case Reports ... sexual arousal, thedrug was later used as an adjunct to psychotherapy. Inthe1980s,MDMAbecameatrendydrugofabuse,par-ticularly at rave parties and dance clubs. However, itspotential for abuse ... having dancedstrenuously and drunk approximately 4L of mineralwater after using the drug. Polyuria, polydipsia and altered capillary glycemia values had been present forapproximately one month,...
- 3
- 327
- 0
Báo cáo y học: " Post-transcriptional control by bacteriophage T4: mRNA decay and inhibition of translation initiation" pdf
... regionsbΔGcRB14UUUUAAUUUAUAAAUACCUCCUAUAAAUACUUAGGAGGUAUUAUGAAUAUAUUU-18.9 RB69UCCUAUAAGUAAUAAAUACCUCCUAUAAACGUGGGAGGUAUUAUGAAUAUAUUU-16.3 T4, othersUUUAAUUUUAUAAAUACCUUCUAUAAAUACUUAGGAGGUAUUAUGAAUAUAUUU-14.7 CC31GAAUGCUAAAUAAAUACUCCUAUCAACUGAUAGGAGGUCCUCAUGGACAUUUUU-12.2 ... CC31GAAUGCUAAAUAAAUACUCCUAUCAACUGAUAGGAGGUCCUCAUGGACAUUUUU-12.2 CUUAGGAGGUAUUAUGAAUAAUACCUCCUAUAAAUUUAUAAAACGUGGG A GGU A UU A UG A AAU A CCUCCU A UAAAAUACUUAGGAGGUAUUAUGA A CCUUCUAU A AC A UAUUUUUUAUAAAACUCCU A UCAACUGAUAGGAGGC******* ... immobilizedRB69 RegA and a variable sequence of 14 bases [75].The selected RB69 RegA RNAs were predominately5’’AAUAAUAAUAAnA-3’, which also did not contain a conserved AUG but were clearly A+ U rich. As discussedby...
- 22
- 383
- 0
Báo cáo y học: " Selective gene silencing by viral delivery of short hairpin RNA" ppsx
... Mode of administration Status CompanyAge-related macular degeneration (AMD) Topical Phase II AllerganRespiratory syncytial virus (RSV) Local/direct Phase II AlnylamLiver cancer (HCC and others) ... fromcapped, polyadenylated transcripts that can also function as mRNAs.RNA 2004, 10:1957-1966.45. Chung KH, Hart CC, Al Bassam S, Avery A, Taylor J, Patel PD, et al:Polycistronic RNA polymerase ... RNAi substrates and aremore amenable to Pol-II transcription and may seem tobe more attractive for therapies [44,45]. But to dateshRNA- and artificial miRNA-based strategies have beencompared...
- 11
- 266
- 0
Tài liệu Báo cáo Y học: Short peptides are not reliable models of thermodynamic and kinetic properties of the N-terminal metal binding site in serum albumin doc
... only the novel data: protonation constantsfor DAHKam and VIHN, and stability constants (log a values) of Cu(II)-VIHN, Cu-DAHKam and Ni-DAHKamsystems. The parameters of CD and EPR spectra of allmajor ... Bal1,21Faculty of Chemistry, University of Wroclaw, Poland;2Institute of Biochemistry and Biophysics, Polish Academy of Sciences,Warsaw, Poland A comparative study of thermodynamic and kinetic aspects of ... HSA and BSA and three simple analogues of the N-terminal binding site. Thesewere: Asp-Ala-His-NH2(DAHam) and Asp-Ala-His-Lys-NH2(DAHKam), which represent the native HSAsequence and Val-Ile-H...
- 9
- 627
- 0
Báo cáo y học: "eening the human exome: a comparison of whole genome and whole transcriptome sequencing" pot
... data for a more easily accessible tissue suchas skin for this exon array publicly available; however, onecan extrapolate that adding cDNA from almost any tissue would be similarly beneficial ... Wefound that at only one lane of RNA-Seq data, the specific-ity was 0.5 for SNVs with a read depth of 3, which was farbetter than the value of 0.28 found when using all eightlanes of data. Again, ... coverage RNA-Seq in the same individual. This comparison allowed us to directly evaluate the sensitivity and specificity of RNA-Seq in identifying coding variants, and to evaluate how key parameters...
- 8
- 299
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP