0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Loss-of-function mutations affecting a specific Glycine max R2R3 MYB transcription factor result in brown hilum and brown seed coats" docx

báo cáo khoa học:

báo cáo khoa học: "Loss-of-function mutations affecting a specific Glycine max R2R3 MYB transcription factor result in brown hilum and brown seed coats" docx

... Y, Kakizaki Y, Yamamoto K,Shimada N, Yamamura S, Nishihara M: Identification and characterizationof R2R3- MYB and bHLH transcription factors regulating anthocyaninbiosynthesis in gentian flowers. ... 18(4):831-851.doi:10.1186/1471-2229-11-155Cite this article as: Gillman et al.: Loss-of -function mutations affecting a specific Glycine max R2R3 MYB transcription factor result in brown hilum and brown seed coats. BMC Plant Biology ... AccessLoss-of-function mutations affecting a specific Glycine max R2R3 MYB transcription factor result in brown hilum and brown seed coatsJason D Gillman1*, Ashley Tetlow2, Jeong-Deong Lee3, J Grover Shannon4and...
  • 12
  • 296
  • 0
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

... polyclonal ASA antiserum.Precipitated ASA was quantified afterSDS ⁄ PAGE with a bio-imaging analyser(Fujifilm). Columns show mean, minimal and maximal deviation of arbitrary units of twoindependent ... were added to the cleared supernatants and incubation continued for 16 h at 4 °C. Five micrograms ofan anti-mouse IgG, raised in rabbits, was added to thesamples containing the mAbs and incubation ... recognized by mAbs A2 and A5 , and amino acid residues 202–206 by mAb C,respectively. For this reason the reduced reactivity ofmAbs A2 and A5 with Gly86Asp and Arg84Gln sub-stituted ASA and mAb C with...
  • 10
  • 504
  • 0
Báo cáo khoa học: Oxidative stress induces a reversible flux of cysteine from tissues to blood in vivo in the rat pptx

Báo cáo khoa học: Oxidative stress induces a reversible flux of cysteine from tissues to blood in vivo in the rat pptx

... ofadministered inorganic mercury. Drug Metab Dispos 25,516–523.51 Shinozuka S, Tanase S & Morino Y (1982) Metabolicconsequences of affinity labeling of cystathionase and alanine aminotransferase ... inhibitor) and propargyl- glycine (a cystathionine c-lyase inhibitor) were performedas described by Zalups and Lash [50] and Shinozuka et al.[51], respectively. Propargylglycine (100 mgÆkg)1intraperi-toneally) ... mgÆkg)1intraperi-toneally) was administered 5 h before starting diamide infu-sion, whereas acivicin was administered in two doses (each10 mgÆkg)1intraperitoneally) 2.5 and 1 h before startingdiamide infusion....
  • 13
  • 510
  • 0
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

... celllysates (Fig. 5A, lane 2). This smear was marginallyrevealed in the unstimulated cells (Fig. 5A, lane 1).These data strongly indicate that SDF-1 induces a rapid and significant increase in the ... hepari-tinase I and III mixture, we suggest the involvement of syndecan-4 and heparan sulfate in p44 ⁄ p42 mitogen-activated protein kinase and Jun N-ter-minal ⁄ stress-activated protein kinase activation ... stromalcell-derived factor (SDF) -1alpha. Glycobiology 10, 21–29.34 Valenzuela-Fernandez A, Palanche T, Amara A, Mage-rus A, Altmeyer R, Delaunay T, Virelizier JL, BaleuxF, Galzi JL & Arenzana-Seisdedos...
  • 15
  • 423
  • 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

... It has been speculated thatAa-Pri1, and similar proteins, may have important roles in the initial phase of fungal fruiting, such as hyphae aggre-gation [4], or in apoptosis [1]. Their exact ... Z. Espinar, M.T. & Labare`re, J. (1997) Cloning and sequencing of the Aa-Pri1 gene specifically expressed duringfruiting initiation in the edible mushroom Agrocybe aegerita, and analysis ... fluorescence increase was rather fast, as shown in Fig. 8B. Fluorescence intensity was maximal at a lipid/protein ratio (w/w) above 16.3, corresponding to anapproximate molar ratio of 400. No changes...
  • 12
  • 492
  • 0
báo cáo khoa học:

báo cáo khoa học: " How to develop a program to increase influenza vaccine uptake among workers in health care settings?" potx

... annual human influenza- Explain avian influenza on websiteAll HCWs should getvaccinatedHCWs understand the ethical aspects of influenzavaccination among HCWs- Explain and discuss ethical ... information meetingConducting an information meeting Execute an information meeting with plenary information oninfluenza and influenza vaccination and discussion in smallergroupsInformation ... influenzavaccination attitudes at a Canadian cancer center. Am J Infect Control2005, 33:243-250.24. O’Reilly FW, Cran GW, Stevens AB: Factors affecting influenza vaccineuptake among health care...
  • 9
  • 353
  • 0
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

... 4-coumarate, caffeate, ferulate,sinapate and 3,4-dimethoxycinnamate, whereas it showedvery low activity towards cinnamate. The recombinant4CL2 was able to convert cinnamate, 4-coumarate, caffeate, and ... given in parentheses): Arabidopsis thaliana 4CL1 (U18675), A. thaliana 4CL2 (AF106086), A. thaliana 4CL3(AF106088), G. max 4CL1 (AF279267), G. max 4CL2(AF002259), G. max 4CL3 (AF002258), G. max ... 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢4CL3-HindIII 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢4CL13–3¢KpnI5¢-AGTTTCAGGGTCAACAACCCTG-3¢4CL13-EcoRI 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢4CL14-BamHI 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢4CL14-GSP1...
  • 12
  • 448
  • 0
Báo cáo khoa học: Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebrafish (Danio rerio) pptx

Báo cáo khoa học: Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebrafish (Danio rerio) pptx

... generallyfound in the ovary and adrenal gland. In fishes, theadrenal homolog is not as compact as the adrenal glandfound in mammals. In fishes, adrenal tissue exists asaminergic chromaffin and inter-regnal ... intracellular function(s). In vitro binding assaysrevealed a surprisingly low affinity of recombinant-derived human FABP6 and rat Fabp6 for long-chainfatty acids, such as palmitate and oleate, ... luteal cells of the ovary and a subpopulation of steroid endocrine cells of theadrenal gland. Sato et al. [13] also detected rat FABP6 in the adrenal gland and ovary. In adult mouse, Fabp6transcripts...
  • 10
  • 379
  • 0
Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

... 5¢-GATACGTCTCTC ACTCAAGGGATTGTAGCCTTCCGGCAGCATCTACAGAATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAGGAACCCCTTGGTCCTCGCGAGATTCTGTAGATGCTGCCGGAAGGCTACAATCCCTTGAGTGAGAGACGTATC and 5¢-GATACGTCCCTTACACAAGGACTTAAGGCATTTAGACAACAGCTTCGGAAGAATGCTAGAACCAAAGGATTTCTG/5¢- ... and 5 ¢-CTTGCTAGAACCAAAGGATTTCTGGGGTTGAACAAAATAAAAGGGCTGGCTCGGCAAATGGGATCAAACGCAGAC/5¢-GTCTGCGTTTGATCCCATTTGTCGAGC CAGCCCTTTTATTTTGTTCAACCCCAGAAATCCTTTGGTTCTAGCAAG.The mammalian expression ... 5¢-AAAGAATTCCTGTGGCAGGGGACCAGTGG; 708R: 5¢-AAAGAATTCGGGCTGGAGGAGGGGCGTTG; 632R: 5¢-AAAGAATTCCGGGGTGTGGAAGGTACTCA; 572R: 5¢-AAAGAATTCCTCCTGGAAGCTGACAGG; 341R: 5¢-AAAGAATTCGAGCAGGAGGTAGTAAAT; the...
  • 13
  • 440
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ⁄ W168F ⁄ Y74W TCACCGGTCCATGATCCATT HaeIIIEffect ... mutations Mousumi Banerjee1, Hemalatha Balaram2 and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram...
  • 15
  • 635
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ