0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Sensitivity of mice to lipopolysaccharide is increased by a high saturated fat and cholesterol diet" pptx

Báo cáo y học:

Báo cáo y học: "Sensitivity of mice to lipopolysaccharide is increased by a high saturated fat and cholesterol diet" pptx

... murine VCAM-1 and iNOS promoters are activated by AP-1, NFkB, and by STAT1 and its secondary target, inter-feron regulatory factor-1 [12-14,44]. TNFα is a strong acti-vator of AP-1 and NFkB, and ... for citation purposes)Journal of InflammationOpen AccessResearchSensitivity of mice to lipopolysaccharide is increased by a high saturated fat and cholesterol dietHong Huang1,3, Tongzheng ... Blue colla-gen staining was defined, and the extent of fibrosis, as a percentage of total tissue area in each image, was calcu-lated using Image Pro Plus image analysis software(Media Cybernetics,...
  • 11
  • 281
  • 0
Báo cáo y học:

Báo cáo y học: "Modulation of interleukin-1b-induced inflammatory responses by a synthetic cationic innate defence regulator peptide, IDR-1002, in synovial fibroblasts" docx

... PrimerIL-1RA ttggaaggctctgaacctca ctgaaggcttgcatcttgctSIGIRR ctcagagccatgccaggt cctcagcacctggtcttca18sRNA gtaacccgttgaaccccatt ccatccaatcggtagtagcgTurner-Brannen et al. Arthritis Research & Therapy ... themanagement of inflammatory arthritis and possiblyother diseases characterized by chronic inflammation.Materials and methodsCell isolation and cultureSynovial tissues were obtained from patients ... example, macrophages and T-lympho-cytes). Activ ation of FLS by pro-inflammatory cytokinesresults in the production of inflammatory cytokines,chemokines, and matrix-degrading matrix metallopepti-dases...
  • 14
  • 271
  • 0
Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx

Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx

... hydrolyse Ala-Ala-pNA and Ala-pNA (or other chromogenic amino acids) at reason-able rates clearly indicates exclusive cleavage of the anilidebond of Ala-Ala-Val-Ala-pNA. Our results also provideconvincing ... Ala-Ala-Val-Ala-pNA or Ala-Pro-pNA, exhibiting precisely thesequence of FRAP-TGase.Yellowing of the Ala-Ala-Val-Ala-pNA solution must bethe result of direct cleavage of the anilide bond. Ala-pNA and ... and Ala()2) implies formation of AP-TGase which is resistant to SM-TAP proteolysis. Ultimately, truncation of the tripeptide Phe-Arg-Ala would yield P-TGase as a finalproduct, as Pro-pNA is also...
  • 7
  • 480
  • 0
Báo cáo y học:

Báo cáo y học: " Perception of urge-to-cough and dyspnea in healthy smokers with decreased cough reflex sensitivity" potx

... urge- to- cough and dyspnea may share common pathways and somatosensory areas [11]. Both the urge -to- cough and dyspnea can arise from stimulation by chemical sub-stances and changes in the mechanical ... dyspnea and the urge -to- cough are the result of sensory activa-tion of subcortical and cortical neural pathways. Some of these pathways are shared across respiratory modal-ities while activation ... mechanical environment act-ing on receptors in the lung and airways [12]. Somepulmonary and airway sensory receptors and afferentpathways may be co mmon to both the urge -to- cough and dyspnea [11]....
  • 7
  • 260
  • 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

... lactoferrin with a lanthanide ion (Sm3+)at3. 4A ˚resolution. Acta Crystallogr. D55,1799–1804.36. Kitamura, T., Gatmaitan, Z. & Arias, I.M. (1990) Serial quanti-tative image analysis and ... lM.ICP-AES was also used to study the binding ratio of Yb3+ to apo-Tf. After addition of 2.0 and 2.5 mol equiv of Yb3+ to apo-Tf, the final ratios of Yb3+ to Tf, after removal of lowmolecular mass ... The almost identical molar absorptivity of e1 and e and approximately the same slope of the k1 and k (Fig. 3)suggests that thenatureofthefirstkineticphaseofthereactionbetween Yb3+ and apo-Tf...
  • 9
  • 385
  • 0
Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot

Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot

... Forward primerAcs 5¢-TAATACGACTCACTATAGGGA*5¢-AACACACCATTCCTGCCAAC-3¢CCACCACAGGTCGCGCC-3¢AcnB 5¢-TAATACGACTCACTATAGGGA*5¢-CTCACACGCTGCTGATGTTC-3¢CGTGGTTACGCACTTCACC-3¢PrpD 5¢-TAATACGACTCACTATAGGGA*5¢-AACATCGGCGCGATGATCC-3¢TCGCTGCTTCAACTGCCG-3PrpE ... hydroxy or unsaturated dicarboxylic and tricarboxylic acids such as trans-aconitate, threo-2-methyl-isocitrate and erythro-2-methylisocitrate,D-malate and L-malate, and (R)-citramalate and ... trans-aconitate,D-malate and L-malate, fumarate, maleate,D-tartrate and meso-tartrate,D-citramalate and L-citramalate,mesaconate, citraconate, itaconate, and (R,S)-3-methylitaconate.SubstrateConcentration(mM)ActivityUÆmg)1%(2S,3S)-Methylcitrate...
  • 11
  • 615
  • 0
Báo cáo Y học: Contribution of Lys276 to the conformational flexibility of the active site of glutamate decarboxylase from Escherichia coli pptx

Báo cáo Y học: Contribution of Lys276 to the conformational flexibility of the active site of glutamate decarboxylase from Escherichia coli pptx

... concentration of speciesAattime0.Gad activity assayEnzyme activity was assayed by quantitating the reactionproduct, 4-aminobutyrate, by HPLC [24] or using Gabase, a commercial preparation containing ... isoforms,GadA and GadB, 98% identical in amino acid sequence and biochemically indistinguishable [18,19]. Gad catalysesthe irreversible a- decarboxylation of L-glutamate to yield 4-aminobutyrate and ... sulfhydrylase to alanine indicates itsimportance in transamination and as a general base catalyst.Biochemistry 35, 13485–13493.7. Toney, M.D. & Kirsch, J.F. (1992) Bronsted analysis of aspartateaminotransferase...
  • 8
  • 321
  • 0
Báo cáo y học:

Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf

... untreated hypertension, therapywith sympathomimetics or sympatholytics, and cancer).Patients were examined by taking history, physical examina-tion, and laboratory findings (erythrocyte sedimentation ... factor for inflammation.IntroductionRheumatoid arthritis (RA) is a chronic inflammatory diseasecharacterised by intense immune activation within the synovialcompartment of joints and a variety ... Goronzy JJ, Weyand CM: Aging, autoimmunity and arthritis: T-cell senescence and contraction of T-cell repertoire diversity –catalysts of autoimmunity and chronic inflammation. ArthritisRes...
  • 11
  • 363
  • 0
Báo cáo y học:

Báo cáo y học: "Transition of healthy to diseased synovial tissue in rheumatoid arthritis is associated with gain of mesenchymal/fibrotic characteristics" pdf

... 5'-CAGGCGCATGAAGGCAAGTTGGGTAG-3'α-sma 5'-CGTGTTGCCCCTGAAGAGCAT-3' 5'-ACCGCCTGGATAGCCACATACA-3'TLH 5'-TTAAAGGAAAGACACTCCGATCAGAGATGA-3' 5'-AATGTTTCCGGAGTAGGGGAGTCTTTTT-3'β2M 5'-TCTTGTACTACACTGAATTCACCCCCACTGA-3' ... 5'-FAM-cgtgccGGCAGCCAGTTTGAATATAATGTTGAAGGAggcacg-DABCYL-3'α-SMA 5'-FAM-cgtcgCCAAGGCCAACCGGGAgAAAATGACgcgacg-DABCYL-3'TLH 5'-cgtgcgCGTGATAAACTGGATCCTGATATGGCTCTTcgcacg-DABCYL-3'β2M 5'-FAM-cgtgcCCTGCCGTGTGAACCATGTGACTTTGgcacg-DABCYL-3'β2M, ... synovial tissueHaematoxylin and eosin staining on healthy and arthritic synovial tissue. Haematoxylin and eosin staining was performed on synovial biopsies from (a) healthy subjects and (b) Rheumatoid...
  • 10
  • 424
  • 0
Báo cáo y học:

Báo cáo y học: " Predictors of adherence to antiretroviral therapy among people living with HIV/AIDS in resourcelimited setting of southwest ethiopia" pdf

... CDC stage C patien ts had higherrisk of pharmacy non-adherence than a symptomaticpatients. When compared with asymptomatic patients,themultivariateanalysisconfirmedamarkedriskofnon-adherence ... Bivariate analysi s was done to determinepresence of statistically significant association betweenexplanatory variables and the outcome variable. Allexplanatory variables that were associated with ... history of hospitali-zation), adherence to treatment information, symptomsassociated with treatment. To identify clinical markersmedical record was reviewed.Data analysis and processingData...
  • 10
  • 806
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyengbp cl5 and hemocyanin to bacteria is regulated by a serine proteasebáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ