Báo cáo khoa hoc:" Generation of a panel of antibodies against proteins encoded on human chromosome 21" pps

... 5′-CATCAGCCC TAATCCATCTGA-3′ r:5′-CGCGACTAACAA TCAAAGTGA-3′, control primersf: 5′ -CTAGGCCACAGAATTGAAAGATCT-3′ r: 5′ -GTAGGTGGAAATTCTAGCATCATC-3′).RNA extraction and RT-PCRRNA w as extra cted ... RESEARC H Open Access Generation of a panel of antibodies against proteins encoded on human chromosome 21Frances K Wiseman1, Olivia Sheppard1, Jacqueline M Linehan1, Sebastian Brandner1, ... 5′-GAATGCGTCCCCAACTTTTCG-3′ r: 5′-GTCGA-TAAGTCGGGAAGCTAC-3′), USP16 (f: 5′-AAGCCTT-CAGTTTGGCTG-3′ r: 5′-GTCCAAACTAAGAACCAGAC-3′), DOPEY2 (f: 5′-ACCTGAGGTACTCCTTGTTG-3′ r: 5′-CCAGGAGAGGAAATAACCCG-3′),...

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into the EcoRV site of ... SantaCruz, CA); monoclonal anti-GFP (1E4, 1 : 750; MBL,Nagoya, Japan); HRP-conjugated monoclonal anti-FLAG(M2, 1 : 3000; Sigma); rabbit anti-actin (1 : 5000; Sigma);HRP-conjugated goat anti-mouse ... that mammalian Gup1, a mem-ber of the MBOAT superfamily bearing sequence simi-larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports havedemonstrated...

Báo cáo khoa học: "Beyond NomBank: A Study of Implicit Arguments for Nominal Predicates" doc

... Hajiˇc, Massimiliano Ciaramita, Richard Johans-son, Daisuke Kawahara, Maria Antònia Mart´ı, Llu´ısMàrquez, Adam Meyers, Joakim Nivre, SebastianPadó, JanˇStˇepánek, Pavel ... a large number of annotated instances.3 Data annotation and analysis3.1 Data annotationImplicit arguments have not been annotated withinthe Penn TreeBank, which is the textual and syn-tactic ... Morristown, NJ, USA. Association for Com-putational Linguistics.Patrick Pantel and Deepak Ravichandran. 2004.Automatically labeling semantic classes. InDaniel Marcu Susan Dumais and Salim Roukos,...

Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf

... recall. The name-based component is built upon HMMs with thehelp of TnT (Brants, 2000). It was trained over a manually annotated corpus of approximately208,000 words, and evaluated against an unseenportion ... is a web center of online lin-guistic services aimed at both demonstrat-ing a range of language technology toolsand at fostering the education, researchand development in natural language ... NLX-Natural Language andSpeech Group. At present, it makes available thefollowing functionalities:• Sentence splitting• Tokenization• Nominal lemmatization• Nominal morphological analysis•...

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATTVps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAGVps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATCYEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGGYEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAGIRA ... CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAGIRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAGIRA R CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGGTable 3. Plasmids used in this study.Plasmid Description SourceYCplac111 CEN4 ARS1 ... The Authors Journal compilation ª 2007 FEBSTable 2. Primers used for mutagenesis.PrimerSequence(5¢-to3¢)Vps4 Upstr F CGCTGCAGTAAGAGCAGTAAACCCGVps4 SalIR GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATTVps4...

Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

... AglC was testedtowards 5 mm pNPaGal, pNPaGalNAc, pNPaAra,pNPaAraf, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha,pNPaXyl, and pNPbGal, and 0.4% galactomannans in40 mm Na acetate pH 5.0, 0.02% BSA, ... a- d-glucosamine (pNPaGlcNAc), a- d-xyl opyranose (pNPaXyl), a- d-manno-pyranose (pNPaMan), a- l-arabinopyranose (pNPaAra), a- l-arabinofuranose (pNP aAraf) and a- l-rhamnopyra-nose (pNPaRha) (less than 10 lm ... trehalose, turanose, rafﬁ-nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc,pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRhaand pNPaXyl were purchased from Sigma (St. Louis, MO,USA). Galactomannans...

Báo cáo khoa học: "Automatically Constructing a Lexicon of Verb Phrase Idiomatic Combinations" pptx

... can motivate a speaker to use a variantin place of a canonical form (Glucksberg, 1993).Nevertheless, lexical and syntactic ﬂexibility maywell be used as partial indicators of semantic ana-lyzability, ... ScienceUniversity of TorontoToronto, ON M5S 3H5Canadaafsaneh@cs.toronto.eduSuzanne StevensonDepartment of Computer ScienceUniversity of TorontoToronto, ON M5S 3H5Canadasuzanne@cs.toronto.eduAbstractWe ... simply take the mostdominant pattern as the canonical one. Instead, wecalculate a -score for the target pair andeach pattern :in which is the mean and the standard deviationover the sample...

báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx

... common complications of this presentation are infections of the urinary tract and retention of urine in the vagina. We present the case of a post-menopausal woman with adnexal mass and abdominal ... ML: Labial fusion: a cause of recurrent urinary tract infections. Clin Pediatr 1973, 12:345-346. 4. Nevarez Bernal RA, Meraz Avila D: Fusion of the labia minora as a cause of urinary incontinence ... formation in the anatomical area of the right adnexa. Our patient had developed a pyosalpinx as a Sequela of labial fusion. At laparoscopy the right pyosalpinx was identified and resected, whereas...

báo cáo khoa học: "Dysphagia as a manifestation of esophageal tuberculosis: a report of two cases" pps

... esophagealtuberculosis: a report of two casesJoana Gomes*, Ana Antunes, Aurora Carvalho and Raquel DuarteAbstractIntroduction: Esophageal involvement by Mycobacterium tuberculosis is rare and ... additional months of rifampicin and isoniazid. Nofurther esophageal dilatations were required and ourpatient has no gastrointestinal complaints.Case twoThe second patient was a Portuguese Caucasian ... compression by the mediastinal or neck lymph nodes[6,7]. Tuberculosis can involve the esophagus as a pri-mary infection or as a secondary manifestation of dis-ease reactivation [8]. Case one was...

báo cáo khoa học:" Tissue engineering: a challenge of today''''s medicine" potx

... envisioned for the future. The artificial generation of hard and soft tissues offers clinicians new tools in thetreatment of various diseases of the head and face region. On the other hand, tissue ... research papers, pub-lished in a wide array of (material-, biological-,biomedical-, biophysical-, and clinical-based) journals,covering all aspects of basic research, preclinical testingand ... therefore as a thematically broad rangedjournal, including all disciplines involved in the head and neck area. We hope this journal will attractbasic researchers and clinicians who are involved...

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ