0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for acute stroke care" doc

báo cáo khoa học:

báo cáo khoa học: " Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for acute stroke care" doc

... purposes) Implementation ScienceOpen AccessResearch article Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for ... approach for diagnostic analysis. The combination of qualitative and quantitative data were able to capture multiple perspectiveson barriers and facilitators to change. These data informed the ... combination of methods identified a complex mix of organisational, teamwork, and specific assessment- relatedfactors as barriers and facilitators for change. Organisational factors are acknowledged...
  • 11
  • 319
  • 0
báo cáo khoa học:

báo cáo khoa học: "Measuring organizational readiness for knowledge translation in chronic care" potx

... r elated measurementtools synthesized in a concept map; a set of core mea-sures for assessing OR for KT that will be available in a database and a searchable website; and a validated OR for ... of Political Science, Université Laval, Québec, Canada.5Faculty of Nursing,University of Alberta, Edmonton, Alberta, Canada.6Ottawa Hospital ResearchInstitute, Ottawa, Canada.7Faculty of Medicine, ... measures of organizational determinants in KT inchronic care services. We are particularly aiming at assessment tools based on theorizing about organizational readiness (OR) that would be used to assess...
  • 10
  • 248
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "An Improved Parser for Data-Oriented Lexical-Functional Analysis" doc

... the performance of the simple RF estimator against the discounted RF estimator. Furthermore, wewant to study the contribution of generalizedfragments to the parse accuracy. We thereforecreated for each ... representation for utterance analyses,• a set of decomposition operations that divide a given utterance analysis into a set of fragments,Note that the computation of the competition probability in the above ... Kaplan, and J. Bresnan, 1982. "Lexical-Functional Grammar: A Formal System for Grammatical Representation", in J. Bresnan(ed.), The Mental Representation of Grammatical Relations, The...
  • 8
  • 408
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Stereotactic body radiotherapy for stage I lung cancer and small lung metastasis: evaluation of an immobilization system for suppression of respiratory tumor movement and preliminary results" ppsx

... Hospital, Nagoya, Japan, 3Nagoya Radiosurgery Center, Nagoya Kyoritsu Hospital, Nagoya, Japan and 4Department of Radiation Therapy, Aizawa Hospital, Matsumoto, JapanEmail: Fumiya Baba* - fbaba@bd5.so-net.ne.jp; ... 2008,70:1229-1238.22. Sasai K, Ono K, Hiraoka M, Tsutsui K, Shibamoto Y, Takahashi M,Hamakawa J, Nadai C, Abe M: The effect of arterial oxygen con-tent on the results of radiation therapy for epidermoid ... linear accelerator (CLINAC 23EX,Varian Medical Systems, Palo Alto, California, USA) with6-MV photons. The planned dose was 44 Gy in 4 fractions for tumors with a maximum diameter of less than...
  • 10
  • 348
  • 0
Báo cáo khoa học: An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel docx

Báo cáo khoa học: An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel docx

... gene.ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATTZ. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channelFEBS Journal 276 ... interdomain flexibility isanother reason for the scarcity of structural data,because of their negative effects on the diffraction qual-ity of protein crystals. Therefore, replacement of the ori-ginal ... indicator used by the program is the root mean square deviation of the overlapping atomsat the spliced site. The coordinates of the best splicedstructure for each fusion candidate were then...
  • 11
  • 395
  • 0
Báo cáo y học:

Báo cáo y học: "Interactions between IL-32 and tumor necrosis factor alpha contribute to the exacerbation of immune-inflammatory diseases" ppt

... 5'-CATCTTCTCAAAATTCGAG-3'Antisense 5'-TGGGAGTAGACAAGGTACAACCC-3'Mouse IL-1β Sense 5'-CAACCAACAAGTGATATTCTCCATG-3'Antisense 5'-GATCCACACTCTCCAGCTGCA-3'Mouse ... 5'-GTCTCCTACCAGACCAAG-3'Antisense 5'-CAAAGTAGACCTGCCCAGACTC-3'Human β-actin Sense 5'-TTCCTGGGCATGGAGTCCT-3'Antisense 5'-AGGAGGAGCAATGATCTTGATC-3'Mouse TNFα ... 5'-GATCCACACTCTCCAGCTGCA-3'Mouse IL-6 Sense 5'-CACTTCACAAGTCGGAGGCTTA-3'Antisense 5'-GCAAGTGCATCATCGTTGTTG-3'Mouse β-actin Sense 5'-AGAGGGAAATCGTGCGTGAC-3'Antisense 5'-CAATAGTGATGACCTGGCCGT-3'TNFα,...
  • 13
  • 552
  • 0
báo cáo khoa học:

báo cáo khoa học: " Single nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis)" potx

... were automatically determinedand then all plots were manually verified. Ambiguouscalls were given an N in the data to indicate that noSNP was reliably determined. To assess the accuracy and ... base calls for allSNPs, determined standard genetic statistics such as jSTor jPTvalues and analyses of mole cular va riance(AMOVA) [41] and exported formatted data for subse-quent analyses ... Food and Agriculture Organization of the United Nations, FAOSTAT.http://faostat.fao.org.10. Vavilov NI: The origin, variation, immunity and breeding of cultivatedplants. Waltham, MA: Chronica...
  • 11
  • 470
  • 0
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

... provides a clear explanation for the inability of P450scc to cleave the side chain of vitaminD3. Hydroxylation of the side chain of cholesterol at the adjacent carbons C22 and C20, to produce2 0a, 22R-dihydroxycholesterol ... which they arose by the action of P450scc, as well as the products that they gave rise to. This revealed both the major and minor pathways for the metabolism of vitamin D3 by P450scc.ResultsMetabolism ... School of Biomolecular, Biomedical and Chemical Sciences, The University of Western Australia, Crawley, Australia2 Department of Pharmaceutical Sciences, College of Pharmacy, University of Tennessee...
  • 12
  • 704
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Translation Model Adaptation for Statistical Machine Translation with Monolingual Topic Information" doc

... 2007.Bilingual LSA-based adaptation for statistical machinetranslation. Machine Translation, pages 187-207.Nicola Ueffing, Gholamreza Haffari and Anoop Sarkar.2008. Semi-supervised Model Adaptation for ... sentences.When the translated texts and the training data comefrom the same domain, SMT systems can achievegood performance, otherwise the translation qualitydegrades dramatically. Therefore, it is of ... domain adap-tation in SMT can be classified into translation mod-el adaptation and language model adaptation. Herewe focus on how to adapt a translation model, whichis trained from the large-scale...
  • 10
  • 533
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Conditional Random Fields for Word Hyphenation" docx

... 90% of the dataset us-ing PATGEN, and then hyphenate the remaining10% of the dataset using Liang’s algorithm and the learned pattern file. The PATGEN tool has many user-settable pa-rameters. As ... all paths that do have a hyphen at this position, divided by the sum of the weights of all paths. The forward-backwardalgorithm uses the sum operator to compute the weight of a set of paths, ... athttp://www.talo.nl/talo/download/documents/Language_Book.pdf.374we show that CRFs can achieve extremely goodperformance on the hyphenation task.2 History of automated hyphenation The earliest software for automatic...
  • 9
  • 607
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ