0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " A randomized controlled trial to prevent glycemic relapse in longitudinal diabetes care: Study protocol (NCT00362193)" pdf

báo cáo khoa học:

báo cáo khoa học: " A randomized controlled trial to prevent glycemic relapse in longitudinal diabetes care: Study protocol (NCT00362193)" pdf

... randomized controlled trial to prevent glycemic relapse in longitudinal diabetes care: Study protocol (NCT00362193)Mary Margaret Huizinga2,3,12, Ayumi Shintani4, Stephanie Michon2, Anne Brown1,5, ... Nashville, TN, USA and 12VA National Quality Scholars Program, Nashville, TN, USAEmail: Mary Margaret Huizinga - mary.margaret.huizinga@vanderbilt.edu; Ayumi Shintani - ayumi.shintani@vanderbilt.edu; ... primary outcome is the glycemic relapse rate at 24months. Relapse is defined as a HbA1c greater than 8%and an absolute 1% increase from baseline. The HbA1cwill be measured at baseline and at...
  • 9
  • 361
  • 0
Báo cáo y học:

Báo cáo y học:A randomized, controlled trial of interferon-β-1a (Avonex®) in patients with rheumatoid arthritis: a pilot study [ISRCTN03626626]" pptx

... relative to baseline, according to ACR criteria;DMARD = disease-modifying antirheumatic drug; IFN = interferon; IL = interleukin; ITT = intention to treat; RA = rheumatoid arthritis.Available ... factor and IL-1, and to down-regulate T-cell activity [2–5]. Since these proin-flammatory cytokines and activated T cells are thought to mediate inflammation and destruction of joint tissue in RA, ... antirheumatic drug; HAQ, HealthAssessment Questionnaire; NSAID, nonsteroidal anti-inflammatory drug; SD, standard deviation; VAS, Visual Analog Scale.open-label study, 4 achieved an ACR 20 response...
  • 5
  • 365
  • 0
báo cáo khoa học:

báo cáo khoa học: " A knowledge synthesis of patient and public involvement in clinical practice guidelines: study protocol" ppsx

... Sociaux de Québec, Montréal, Québec, CanadaEmail: France Légaré* - france.legare@mfa.ulaval.ca; Antoine Boivin - antoine.boivin@gmail.com; Trudy van der Weijden - Trudy.vanderWeijden@HAG.unimaas.nl; ... organizations in Canada have started to call for a CPGs developmentprocess that will engage patients and the public in a moremeaningful and effective way. The Canadian MedicalAssociation, in its 2007 handbook ... clinical practiceguidelines. Can Fam Physician 2007, 53(8):1326-1327.20. Canadian Diabetes Association Clinical Practice Guidelines ExpertCommittee: Canadian Diabetes Association 2003 ClinicalPractice...
  • 8
  • 420
  • 0
Báo cáo y học:

Báo cáo y học: "A randomized controlled trial evaluating the impact of knowledge translation and exchange strategies" docx

... health departments in Canada were invited to participate. Health departments in Canada were identified through provincial databases. Par-ticipants were recruited into the study in a two-stage ... Evanisko MJ: Organizational innovation: The influ-ence of individual, organizational, and contextual factors onhospital adoption of technological and administrative inno-vations. Acad Manage J 1981, ... between specialist and generic serv-ices in improving health care: A cross-national study ofdementia care in England and the Netherlands. InternationalJournal of Health Planning & Management...
  • 16
  • 337
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt

... possible facets.Another key characteristic of rich domainslike financial analysis, is that facts and events aresubject to interpretation in context. To a finan-cial analyst, it makes a difference ... were annotated withthe types of financial transactions they are mostrelated to. Paragraphs that did not fall into a category of interest were classified as “other”.The annotated paragraphs ... etc.133Maytag: A multi-staged approach to identifyingcomplex events in textual dataConrad Chang, Lisa Ferro, John Gibson, Janet Hitzeman, Suzi Lubar, Justin Palmer,Sean Munson, Marc Vilain, and Benjamin...
  • 4
  • 404
  • 0
báo cáo khoa học:

báo cáo khoa học: "The impact of social networks on knowledge transfer in long-term care facilities: Protocol for a study" doc

... andsmaller spaces for more privacy. While there are no tradi-tional nursing stations, there is space for staff to engage in care planning and organization while maintaining visualcontact with ... physical therapists,pharmacists, and social workers, as well as senior manag-ers and administrators) in four nursing homes in Edmon-ton, Alberta. The purposes of this study are to assessfeasibility ... prior to administering thesurveys among staff in a LTC facility not included in this study to ensure that the language is understandable to allstaff and to assess how long it takes to complete...
  • 10
  • 429
  • 0
báo cáo khoa học:

báo cáo khoa học: " A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation" ppt

... theory and adherence to treatment in diabetes. Am J Psychiatry 2001, 158:29-35.44. Australian Institute of Health and Welfare (AIHW): The burden of dis-ease and injury in Australia Canberra: AIHW; ... Disease Studies[44]Regular surveys National Health Survey, ABS Cause of Death statistics etc.Administrative data setsHospital data bases Inpatient minimum datasets, Outpatient minimum datasetsMedicare ... reflecting an understanding of diabetes and protocols for prevention and management by interrogating available data sets; (for example as listed in Table 2). Describe number of persons with diabetes...
  • 9
  • 368
  • 0
báo cáo khoa học:

báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

... ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCAB genome ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCAD genome ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA A B A ... ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA A B A genome CCTCGATTTTATTTTCTAATGTTATTGCAATAGCTCGGTATAATGTAACCATGTTACTAGCTTAAGATGGTTAGGGTTTCCCACTTAGGATGCATGAAATATCGCATTGGAB genome CCTCGATTTTATTTTCTAATTTCTTCATATTGGCAAGTGCATAACTTTGCTTCCTCTCTGT ... large in/ del event relative to the B and D genomes that is represented by bold red letters. A genome ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCAB...
  • 14
  • 324
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật