Báo cáo y học: "Lung contusion and cavitation with exudative plural effusion following extracorporeal shock wave lithotripsy in an adult: a case report " ppt
Báo cáo y học: "Lung contusion and cavitation with exudative plural effusion following extracorporeal shock wave lithotripsy in an adult: a case report." ppt
... AccessLung contusion and cavitation with exudative plural effusion following extracorporeal shock wave lithotripsy in an adult: a case report Nader Nouri-Majalan1*, Roghayyeh Masoumi1, Abolhasan ... the case of a 31-year-old Asian man with an unusual case of hemoptysis and lung contusion and cavitation with exudative plural effusion due to pulmonary trauma following false positioningof extracorporeal ... lithotripsy can cause lung trauma presenting aspulmonary contusion and cavitation with plural effusion. IntroductionAlthough extracorporeal shock wave lithotripsy (ESWL)is useful for the management...
- 3
- 264
- 0
Báo cáo y học: "Lung contusion and cavitation with exudative plural effusion following extracorporeal shock wave lithotripsy in an adult: a case report" potx
... presentation: We describe the case of a 31-year-old Asian man with an unusual case of hemoptysis and lung contusion and cavitation with exudative plural effusion due to pulmonary trauma following false ... CAS E REP O R T Open AccessLung contusion and cavitation with exudative plural effusion following extracorporeal shock wave lithotripsy in an adult: a case report Nader Nouri-Majalan1*, ... Roghayyeh Masoumi1, Abolhasan Halvani2, Sara Moghaddasi1AbstractIntroduction: Among the complications of extracorporeal shock wave lithotripsy are perinephric bleeding and hypertension.Case...
- 3
- 208
- 0
Báo cáo y học: " Lung sealant and morbidity after pleural decortication: a prospective randomized, blinded study" ppsx
... worked, as Consul-tant, until 2009), performed the statistical analysis and participated in design and coordination of the study. PL participated in data collection. EM partici-pated in design and ... properly cited.Research articleLung sealant and morbidity after pleural decortication: a prospective randomized, blinded studyLuca Bertolaccini*1, Paraskevas Lybéris2 and Emilpaolo Manno3AbstractObjectives: ... no additional interventions. In Sealant group, lung sealant was applied over AL areas. Following variables were measured daily: patients with AL; time to chest drainage (CD) removal; CD drainage...
- 4
- 243
- 0
Báo cáo y học: "Blood autoantibody and cytokine profiles predict response to anti-tumor necrosis factor therapy in rheumatoid arthriti" pps
... experiments and types of analysis. Upper panel: in the discovery steps, synovial antigen microarrays and multiplex cytokine assays were employed to determine candidate molecules that are differentially ... single-antigen ELISAs werecombined with the measurements from the bead-arraycytokine assay for integrated analysis of cytokine and autoan-tibody profiles in baseline samples derived from all ... WL and BHT performed the statisti-cal analysis. FB, RFvV, JL, LK, YT, KS, PKG and MCG partici-pated in design and coordination. WH drafted the manuscript.All authors read and approved the final...
- 13
- 299
- 0
Báo cáo y học: "Secondary omental and pectoralis major double flap reconstruction following aggressive sternectomy for deep sternal wound infections after cardiac surgery" ppt
... patient was treated by partial sternectomy and primary wound closure with transposition of omen-tal and pectoralis major flaps and occulusive continuoussaline irrigation (patient 2); and three patients ... 3), and mental health (MH, 5).The norm-based scoring algorithms introduced for alleight scales employ a linear score transforma tion, whichscores scales with a mean of 50 and a standard deviationof ... transposition of omental and/ or bilateral pectoralismajor flaps. In these patients, closed drainage tubeswere inserted around the mediastinal and subcutaneousspace, with continuous or daily...
- 6
- 373
- 0
Báo cáo y học: "Microembolic signals and strategy to prevent gas embolism during extracorporeal membrane oxygenation" ppt
... received a perfu sion assistance accordingto the heart function monitored by transesophagealechocardiogram and metabolic parameters from bloodsampling. Air/oxygen flow was set to maintain a partialoxygen ... morbidity and mor-tality in cardiac surgery procedures [3,4]. We agree thatTCD can be helpful in assessing and monitoring thequality of extracorporeal perfusio n in regard of bloodflow velocity and ... 63(4):998-1002.5. Sato K, Hanzawa K, Okamoto T, Kyo S, Hayashi J: Frequency analysis ofhigh-intensity transient signals of transcranial Doppler ultrasound in patients supported with a left ventricular assist...
- 5
- 319
- 0
Báo cáo y học: " Peripheral blood and neuropsychological markers for the onset of action of antidepressant drugs in patients with Major Depressive Disorder" pps
... immuno-inflammatory system with the aetiology and the pathophysiology of MDD.Recently, a larger panel of pro- a nd anti-inflammatorycytokines was measured in a case/ control population ofMDD showing ... the onset of antidepressants’ action as yet and treatment efficacy is only determined by clinicalmeasures and in the later course of treatment. Currentlyavailable data can not answer the question, ... Centre, Mainz, Germany.3Clinic for Psychiatry and Psychotherapy,Katzenelnbogen, Germany.4Clinic for Psychiatry and Psychotherapy, Dr.Horst-Schmidt-Kliniken, Wiesbaden, Germany.Authors’...
- 10
- 1,241
- 0
Báo cáo y học: "Lung fibroblasts from patients with emphysema show markers of senescence in vitro" pdf
... Germany, 3Fraunhofer Institute of Toxicology and Experimental Medicine, Department for Clinical Inhalation, D-30625 Hannover, Germany and 4Institute and Outpatient Clinic for Occupational and ... NM_000598IGFBP-5 GAGCAAGTCAAGATCGAGAGAGA GAAAGTCCCCGTCAACGTA 463 M65062IGFBP-rP1 CTGCGAGCAAGGTCCTTCCATA CAGGTTGTCCCGGTCACCA 184 NM_001553CTGF [22] CCTGCAGGCTAGAGAAGCAGA TGCACTTTTTGCCCTTCTTAATGT 90 NM_001901Cyr61 ... quality confirmed by theAgilent Bioanalyzer™ and radio-labeled cDNA probeswere hybridized to one array per group. After global nor-malization and additional correction for GAPDH and β-actin,...
- 10
- 337
- 0
Báo cáo y học: "Influence of Cyclodextrin Complexation with NSAIDs on NSAID/Cold Stress-Induced Gastric Ulceration in Rats"
... et al. Oxidative stress and antioxidants status in peptic ulcer and gastric carcinoma. Indian J Physiol Pharmacol. 2004; 48: 115-8. 47. Tanaka A, Hatazawa R, Takahira Y, et al. Preconditioning ... evaluation of indomethacin/cyclodextrin complexes gastrointestinal to-lerance and dermal antiiflammatory activity. Int J Pharm. 1994; 106: 63-7. 22. Jambhekar S, Casella R, Maher T. The physicochemical ... oral use. They act as protective agents against ga-strointestinal disorders initiated by restraint and cold stress, or by restraint and cold stress and the co-administration of either indomethacin...
- 8
- 529
- 0
Báo cáo y học: "AP-43 expression correlates with spinal motoneuron regeneration following root avulsion" ppt
... and ana-lyzed data; KFS analyzed data; ZL analyzed data; WWdesigned the study, collected and analyzed data, wrote themanuscript. All authors read and approved the final man-uscript.AcknowledgementsThis ... interests.Authors' contributionsQY performed experiments, collected and analyzed data,was involved in study design and wrote the manuscript;BH. collected and analyzed data; HS. collected and ana-lyzed ... robust axonalregeneration in adult and the absence of GAP-43 expres-sion and axonal regeneration in neonatal suggest thatGAP-43 plays an important role in regeneration ofavulsed spinal motoneurons....
- 6
- 247
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)