0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Oxygen supplementation facilitating successful prosthetic fitting and rehabilitation of a patient with severe chronic obstructive pulmonary disease following trans-tibial amputation: a case report" potx

báo cáo khoa học:

báo cáo khoa học: "Oxygen supplementation facilitating successful prosthetic fitting and rehabilitation of a patient with severe chronic obstructive pulmonary disease following trans-tibial amputation: a case report" potx

... Oxygen supplementation facilitating successful prosthetic fitting and rehabilitation of a patient with severe chronic obstructive pulmonary disease following trans-tibial amputation: a case report. ... trans-tibial amputation 40-60%,unilateral trans-femoral amputation 90 to 120%, bilateral trans-tibial amputation 60-100% and bilateral trans-femoral amputation > 200%. Patients with severe chronic obstructive ... COPD.ConclusionsPatients with lower-limb amputations with severe oradvanced COPD are generally not considered candidatesfor prosthetic fitting and rehabilitation. However, wedescribe a case of a 67-year-old...
  • 4
  • 274
  • 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... The Authors Journal compilation ª 2010 FEBSStaphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acidYang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk bindsto translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal ... structure. The mutationsites are displayed as side chains and located in domain III, domain V and the interface of domains G, III and V. (B) Mutation sites in domainIII that may affect the FA-binding...
  • 15
  • 474
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Antithrombin supplementation for anticoagulation during continuous hemofiltration in critically ill patients with septic shock: a case-control study" pdf

... of septic shock has increased drastically duringpast years. Septic shock patients have mortality rate of about60% and an excess risk of death of about 25% when com-pared with non-septic patients ... latter study, AT was associated with anincreased risk of hemorrhage when it was administered with heparin. On the other hand, in heparin-resistant patientsundergoing cardiac surgery with cardiopulmonary ... despite adequate anticoagulation [9]. In 2000 Wil-liams and colleagues [10] showed, in a randomized trial inpatients requiring cardiopulmonary bypass, that heparin resist-ance was frequently associated...
  • 7
  • 275
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) 2913–2926 ª 2011 The Authors Journal compilation ª 2011...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "The Arabic Online Commentary Dataset: an Annotated Dataset of Informal Arabic with High Dialectal Content" pdf

... speech data) and take a phone recog-nition and language modeling approach (Zissman,1996). In a four-way classification task (with Iraqias a fourth dialect), they achieve a 78.5% accuracyrate. ... linguisticresearch, especially in textual form.The abundance of MSA data has greatly aided re-search on computational methods applied to Arabic,but only the MSA variant of it. A state -of- the-artArabic-to-English ... Speech and Language Data With Amazon’s Mechanical Turk, pages 108–113.Yun Lei and John H. L. Hansen. 2011. Dialect clas-sification via text-independent training and testing forarabic, spanish, and...
  • 5
  • 418
  • 1
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Finding Synonyms Using Automatic Word Alignment and Measures of Distributional Similarity" pdf

... other languages found in parallel cor-pora are seen as the (translational) context of thatword. We assume that words that share transla-tional contexts are semantically related. Hence,relatedness ... observations made by otherresearchers (Kilgarriff and Yallop, 2000) we can state thatthis approach generates a type of semantic similarity that is of a looser kind, an associative kind,for example ... syntax-based approaches and multilingual alignment-based approaches and compare their performancewhen using the same similarity measures and eval-uation set.2 Related WorkMonolingual syntax-based...
  • 8
  • 516
  • 0
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx

Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx

... plasminogen activator activity of normal human kerati-nocytes. J. Invest. Dermatol. 101 , 49±53.46. Jaakkola, P., Maatta, A. & Jalkanen, M. (1998) The activation and composition of FiRE (an F GF-inducible ... ngáml)1FSH and increasing concentrations of bFGF (lanes 2 to 6). TotalRNA was extracted as described in Materials a nd m ethods. Then, 500 ng RNA was reverse-transcribed and am pli®ed by relative quantitativeRT-PCR ... incubated for 24 hwithout treatment. T otal RNA was extractedas described in M aterials and methods. ThenRNA (500 ng) was reverse transcribed a ndampli®ed by relative q uantitative RT-PCR asdescribed...
  • 10
  • 624
  • 0
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

... transferase; pink, maltogenic a- amylase; blue, a- amylases from Bacillus and actinomycetes; light blue, a- amylases from fungi and yeast; green, maltotetraohydrolases and maltopentaohydrolase. A ... Reference withdrawn.75. Takada, M., Nakagawa, Y. & Yamamoto, M. (2003) Biochem-ical and genetic analyses of a novel c-cyclodextrin glucano-transferase from an alkalophilic Bacillus clarkii ... mutagenesis of histidine 93, aspartic acid 180, glutamicacid 205, histidine 290, and aspartic acid 291 at the active site and tryptophan 279 at the raw starch binding site in barley a- amylase1....
  • 11
  • 615
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Viterbi Training for PCFGs: Hardness Results and Competitiveness of Uniform Initialization" doc

... becausewhenever we have an appearance of the ruleVYr→ 0, we have an adjacent appearance of the rule V¯Yr→ 1 (because we parse substrings of the form 10), and then again we use the factthat all rules ... 200 6a; McClosky et al., 2006b). With self-training, the model is learned with some seed an-notated data, and then iterates by labeling new,unannotated data and adding it to the original an-notated ... (Notethat there always exist some parameters θφthatgenerate sφ.) So, again, given an algorithm forConditionalViterbiTrain, we can discern between a satisfiable formula and an unsatisfiable...
  • 10
  • 413
  • 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

... 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ 43N302F 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 43I30 3A 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ ... 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 55R103E 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 55DKR 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 48N302D 5¢-CATTGTTGAAGACATCAATGTTG-3¢ ... triple mutants.Mutant Sense Primer Antisense Primer TmR101M 5¢-GAGTTTGGTTCGATGACAAGGAATGTTG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 58R103M 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢...
  • 12
  • 380
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP