... 4:307
http://www.jmedicalcasereports.com/content/4/1/307
Page 4 of 4
CAS E REP O R T Open Access
Elevated transaminases as a predictor of coma in
a patient with anorexia nervosa: a case report
and review of the literature
Shuhei Yoshida
1,2*
, Masahiko ... of the liver was higher than that of the spleen in a
patient with AN and elevate...
... pathways
such as activation of the capping protein gelsolin [10]
and myosin light chain kinase. Intracellular Ca
2+
was
measured by loading with the calcium reporter dye
Oregon Green-BAPTA 1-AM and monitoring ... distinct pattern of intracellular Ca
2+
signalling was
observed in platelets on thrombin. An initial rapid ele-
vation in intracellular Ca
2+
was followed by a...
... vaccination pigs were variable in the level
of maternal antibody titers (<1:4~1:256). Mean antibody
titers of each group against HCV increased gradually after
the vaccination of the attenuated ... one
of the major diseases that are threatening the expanding
Korean swine industry since 1947 [7]. Thus, the national
eradication program of a virulent hog cholera virus...
... concentration of partially active GC vari-
ants, as demonstrated by increased cellular GC activity,
an increased concentration of lysosomal GC glyco-
forms and increased colocalization of GC with the ... hydro-
lase activity. That said, the fractional activity appears
to be sufficient to ameliorate disease, when folding and
trafficking efficiency is increased, resulting in an...
... and characterizing
individual mutant proteins, these combinatorial approaches
offer the important advantage of simultaneously generating
libraries of protein variants, thus allowing a much larger
number ... binding
partner (stability- or affinity-based), one could divide a
phage library in half and sort one half against a binding
partner and the other half against an expr...
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) ... (5¢-TGGTACTCGAG
CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) an...
... the atoms subst(S, 1.self) and step(1)
and a final state consisting of the following goal:
A, u.¬subst (A, u) ∧ A, u.¬mustadjoin (A, u).
We can then send the actions and the initial state
and goal ... existence of the individual r before the utterance
we are generating. We model this by marking r as
hearer-new in the pragmatic knowledge base and as-
signing...
... (LDA).Thisstatistical
multivariate method is supervised. It searches for the
variables containing the greatest interclass variance and
the smallest intraclass variance, and constructs a linear
combination ... Many
parameters can be adjusted for increasing the efficiency of
the algorithm. The data were analysed with a window of five
wavenumbers, assuming that adjacent w...
... stabilities of the adducts of
C5 MTases with DNA duplexes containing AzaC, FC or
2P in place of the target C in the presence of AdoMet. The
adducts of M.EcoRII with AzaC DNA [5] and M.HhaI
with FC DNA ... methyl
transfer was detected in the case of duplex I lacking the
HhaI recognition sequence (data not shown). Therefore, as
in the case of M....
... acid-substituted ASAs
via the proteasome
In order to investigate the degradation pathway of
amino acid-substituted ASAs in the ER, we used Ltk
–
Fig. 2. Immunoprecipitation of amino acid-substituted ASAs with
structure-sensitive ... mechanisms cause
ASA deficiency. In about half of the examined cases the
mutant enzymes are retained in the ER [2,9,10], in the
oth...