báo cáo khoa học: " Inadvertent malposition of a permanent pacemaker ventricular lead into the left ventricle which was initially missed and diagnosed two years later: a case report" pptx

báo cáo khoa học: " Inadvertent malposition of a permanent pacemaker ventricular lead into the left ventricle which was initially missed and diagnosed two years later: a case report" pptx

báo cáo khoa học: " Inadvertent malposition of a permanent pacemaker ventricular lead into the left ventricle which was initially missed and diagnosed two years later: a case report" pptx

... 5:54 http://www.jmedicalcasereports.com/content/5/1/54 Page 2 of 5 CAS E REP O R T Open Access Inadvertent malposition of a permanent pacemaker ventricular lead into the left ventricle which was initially missed and diagnosed two years later: a case ... placement. Case presentation: We report a case of a 60-year-old Caucasian man with...
Ngày tải lên : 11/08/2014, 00:22
  • 5
  • 235
  • 0
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

... longicornis, which has a wide geo- graphical distribution in Russia, eastern Asia, Austra- lia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites ... act as vectors of disease-causing agents in humans and animals by injecting their saliva, which contains anticoagulants and other bioactive com- ponents as well...
Ngày tải lên : 16/03/2014, 10:20
  • 14
  • 432
  • 0
Báo cáo khoa học: Endosomal proteolysis of diphtheria toxin without toxin translocation into the cytosol of rat liver in vivo pdf

Báo cáo khoa học: Endosomal proteolysis of diphtheria toxin without toxin translocation into the cytosol of rat liver in vivo pdf

... kDa) and DT -A subunit ( 25 kDa). Arrows in (B) indicate the mobilities of intact DT ( 62 kDa) and uncharacterized DT fragments (60, 35 and 12 kDa). Activation and translocation of diphtheria ... Biochemical characterization revealed that the neutral endosomal DT-degrading activity was due to a novel luminal 70-kDa furin enzyme, whereas the aspartic acid protease cath...
Ngày tải lên : 23/03/2014, 07:20
  • 15
  • 195
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ... maintaining the geometry of the active site. The availability of crystal structures of TIMs from 21 sources and the large database of TIM sequences from various sources facilita...
Ngày tải lên : 18/02/2014, 11:20
  • 15
  • 635
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... 5¢-CGCCTCGAGCTATTTGGGCTCTT TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢- CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢; rOMM-64-III, 5¢-CGCGGATCCG...
Ngày tải lên : 18/02/2014, 17:20
  • 12
  • 568
  • 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... at the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. The ... vanished after 30 min, and instead, an absorption peak appeared at 637 nm, suggesting the formation of CO–verdoheme. The 637 nm band disappeared gradu- ally and was repl...
Ngày tải lên : 19/02/2014, 05:20
  • 16
  • 617
  • 0
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

... 4 A ˚ of the cofactor, of which 15 are identical in the bacterial, trypanosomal and mammalian PDH. The binding of NADP + is similar to that in OaPDH, however, differ- ences do exist. First, at ... His453 and a water molecule. The C3-OH forms hydrogen-bonding interactions with the catalytic Lys184 and two asparag- ines (Asn188 and Asn102). Lys184 also interacts...
Ngày tải lên : 19/02/2014, 05:20
  • 12
  • 452
  • 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... substituents with amino acids of the antibody, and that the protein provided a partial steric hindrance of the distal face of the heme [2]. In addition, it was shown recently that 3A3 –MP8 was a more efficient catalyst ... This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is characteristic of the heme...
Ngày tải lên : 19/02/2014, 12:20
  • 7
  • 447
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

... First, whereas the overall exposed surface areas of the psy- chro- and the mesophilic enzymes are larger than for the thermophile enzyme, mainly as a result of larger area of apolar atoms, the meso- and ... 6, 501–523. 50 Feller G, Payan F, Theys F, Qian M, Haser R & Gerday C (1994) Stability and structural analysis of alpha-amylase from the antarctic psychroph...
Ngày tải lên : 19/02/2014, 16:20
  • 14
  • 597
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... h and then cut with ClaI (C and D). DNA was separated by electrophoresis on an agarose gel and the ethidium bromide fluorescence recorded to quantify DNA (A and C). The DNA was then electrotransferred ... present and was independent of the size of the DNA fragment (Fig. 3A, lane 1). As mtDNA in vivo is negatively supercoiled it was also important to compare the...
Ngày tải lên : 20/02/2014, 11:20
  • 10
  • 638
  • 0

Xem thêm

Từ khóa: