báo cáo khoa học: " Inadvertent malposition of a permanent pacemaker ventricular lead into the left ventricle which was initially missed and diagnosed two years later: a case report" pptx
... 5:54
http://www.jmedicalcasereports.com/content/5/1/54
Page 2 of 5
CAS E REP O R T Open Access
Inadvertent malposition of a permanent
pacemaker ventricular lead into the left ventricle
which was initially missed and diagnosed two
years later: a case ... placement.
Case presentation: We report a case of a 60-year-old Caucasian man with...
... longicornis, which has a wide geo-
graphical distribution in Russia, eastern Asia, Austra-
lia, and New Zealand, and has the potential to
transmit pathogens including viruses, rickettsia and
protozoan parasites ... act as vectors of disease-causing
agents in humans and animals by injecting their saliva,
which contains anticoagulants and other bioactive com-
ponents as well...
... kDa) and DT -A
subunit ( 25 kDa). Arrows in (B) indicate the mobilities of intact DT ( 62 kDa) and uncharacterized DT fragments (60, 35 and 12 kDa).
Activation and translocation of diphtheria ... Biochemical characterization revealed that the neutral endosomal
DT-degrading activity was due to a novel luminal 70-kDa furin enzyme,
whereas the aspartic acid protease cath...
... site
W11F WT W11F CA
CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI
W168F WT W168F GAACCTTTATTCGCTATT
GGTACCGGTAAA KpnI
WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT
GGTACCGGTAAA KpnI
Y74W* WT* W11F ... maintaining the geometry of the
active site. The availability of crystal structures of
TIMs from 21 sources and the large database of TIM
sequences from various sources facilita...
... at the
same time, distinct absorption bands of oxyheme
appeared at 540 and 579 nm. Then, a broad band
appeared at around 660 nm, and was maximal 9–12 min
after initiation of the reaction. The ... vanished
after 30 min, and instead, an absorption peak
appeared at 637 nm, suggesting the formation of
CO–verdoheme. The 637 nm band disappeared gradu-
ally and was repl...
... 4 A
˚
of the
cofactor, of which 15 are identical in the bacterial,
trypanosomal and mammalian PDH. The binding of
NADP
+
is similar to that in OaPDH, however, differ-
ences do exist. First, at ... His453 and a
water molecule. The C3-OH forms hydrogen-bonding
interactions with the catalytic Lys184 and two asparag-
ines (Asn188 and Asn102). Lys184 also interacts...
... substituents with amino acids of the
antibody, and that the protein provided a partial steric
hindrance of the distal face of the heme [2]. In addition,
it was shown recently that 3A3 –MP8 was a more efficient
catalyst ... This was shown by a
progressive disappearance, in its absorption spectrum, of
the soret band at 396 nm that is characteristic of the heme...
... First,
whereas the overall exposed surface areas of the psy-
chro- and the mesophilic enzymes are larger than for
the thermophile enzyme, mainly as a result of larger
area of apolar atoms, the meso- and ... 6,
501–523.
50 Feller G, Payan F, Theys F, Qian M, Haser R &
Gerday C (1994) Stability and structural analysis of
alpha-amylase from the antarctic psychroph...
... h and then cut with ClaI (C and D).
DNA was separated by electrophoresis on an agarose gel and the
ethidium bromide fluorescence recorded to quantify DNA (A and C).
The DNA was then electrotransferred ... present and was independent of the size of the DNA
fragment (Fig. 3A, lane 1). As mtDNA in vivo is negatively
supercoiled it was also important to compare the...