0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "An osseous lesion in a 10-year-old boy with Hodgkin’s lymphoma: a case report" ppsx

báo cáo khoa học:

báo cáo khoa học: "An osseous lesion in a 10-year-old boy with Hodgkin’s lymphoma: a case report" ppsx

... in a 10-year-old boy with Hodgkin’s lymphoma: a case reportMachiel van den Akker1*, Vadiem Zudekov2, Asher Moser3and Joseph Kapelushnik3AbstractIntroduction: Osseous involvement of Hodgkin’s ... Hodgkinlymphoma. Pediatr Blood Cancer 2008, 51:198-203.doi:10.1186/1752-1947-5-511Cite this article as: van den Akker et al.: An osseous lesion in a 10-year-old boy with Hodgkin’s lymphoma: a case report. ... Hodgkin’s lymphoma is uncommon. When osteolytic lesions are seen onimaging it is important to evaluate potential other causes. Case presentation: We report the case of a 10-year-old Caucasian boy...
  • 3
  • 261
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 ... Purification and characterization of a transmembrane domain-deleted form of lecithinretinol acyltransferase. Biochemistry 42, 6090–6098.45 Muniz A, Villazana-Espinoza ET, Thackeray B & TsinAT...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... visualized by staining with Coomassie brilliant blue [45] or silver [46]. The proteinconcentration of samples was determined according to theLowry method [47], with BSA as a standard.Purification ... enzyme was incubated with 1.5% N-lauroylsarco-sine at 68 °C for 20 min. After cooling to 20 °C,(NH4)2SO4was added to a saturation of 68%. After 2 h ofincubation at 20 °C, the precipitated ... Iwamoto-Kihara A, Ueda I, Yanagida T, Wada Y & Futai M(1999) Mechanical rotation of the c subunit oligomer in ATP synthase (F0F1): direct observation. Science 286,1722–1724.5 Hirata...
  • 9
  • 773
  • 0
Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx

Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx

... oligomer and blotted against c1antibodies. Lane 4: ATP synthase was incubated for 10 min at 80 °C, and blottedagainst c1antibodies. Lane 5: the sample was incubated for 10 min at 80 °C and hybridized ... synthes-ized at a rate of about 40 mol ATPÆ(mol pro-tein))1Æmin)1. When a DY was applied separately, ATPwas synthesized at a rate comparable to that with electrochemical sodium ion potential (DlNa+) ... (B). Lane 1: molecular mass marker. Lane 2: ATP syn-thase preparation was denatured by incubation at 80 °C for 10 min. Lane 3: ATP synthase was heated for 5 min at 120 °C prior toSDS ⁄ PAGE to...
  • 8
  • 486
  • 0
báo cáo khoa học:

báo cáo khoa học: "An attempt to modify allelic frequencies at the Adh locus of a Drosophila melanogaster population in a tropical environment" pot

... genetically markedby a rare biochemical allele was released in a small, isolated natural population in tropical Africa. Surprisingly, only a slight, short-term modification was ... closevicinity of the banana baits. Prior to release, a sample of native flies was taken todetermine the allelic frequencies in the natural population. Another sample was takenat ... Gif-sur-YvetteSummaryOne thousand laboratory-reared adults, homozygous for the AdhF allele of the alcoholdehydrogenase locus, were released in a tropical environment harboring a natural...
  • 6
  • 251
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "An Entity-Mention Model for Coreference Resolution with Inductive Logic Programming" pdf

... recall and precision rates.By default, the ALEPH algorithm only generatesrules that have 100% accuracy for the training data.And each rule contains at most three predicates. Toaccommodate ... to allow rules that have above50% accuracy and contain up to ten predicates. De-fault parameters were applied for all the other set-tings in ALEPH as well as other learning algorithmsused in ... rule, a pronominalmention should be linked with a partial entity whichcontains a named-entity and contains an indefiniteNP in a subject position. This supports the claims in (Yang et al., 200 4a) ...
  • 9
  • 476
  • 2
Báo cáo khoa học:

Báo cáo khoa học: "Enhancing Language Models in Statistical Machine Translation with Backward N-grams and Mutual Information Triggers" ppt

... 2007. Large language mod-els in machine translation. In Proceedings of the2007 Joint Conference on Empirical Methods in Nat-ural Language Processing and Computational Natu-ral Language Learning ... translation. In Proceed-ings of AMTA.Sylvain Raybaud, Caroline Lavecchia, David Langlois,and Kamel Sma¨ıli. 2009. New confidence measuresfor statistical machine translation. In Proceedings ... LinguisticsEnhancing Language Models in Statistical Machine Translation with Backward N-grams and Mutual Information TriggersDeyi Xiong, Min Zhang, Haizhou LiHuman Language TechnologyInstitute for Infocomm...
  • 10
  • 415
  • 0
Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf

Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf

... organisms as diverse as Neurospora crassa,Candida tropicalis, Dictyostelium discoideum, Medicagovaria (alfalfa), Arabidopsis t haliana, Oryza sativa (rice),Caenorhabditis elegans, Drosophila m elanogaster, ... from a single ancestral Bsubunit. In summary, in this study we have de®ned t wo separatePP 2A b inding domains in the regulatory a nd targeting B 5 6a subunit, which a re conserved in sequence a ... 2). A seconddomain e xtending from amino acids 325 ±383 wa s capable ofindependently binding to GST -A ( Fig. 2). These regionswere named A subunit b inding domains (ASBD) 1 and 2.Given that...
  • 7
  • 550
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "An Automatic Method for Summary Evaluation Using Multiple Evaluation Results by a Manual Method" pptx

... combine the manual scores of the pooled summaries? Kazawa et al. calculated the score of a summary as a weighted linear sum of the manual scores. Applying regression analysis (Yasuda et al., ... accurately as manual methods. In this paper, we investigate an automatic method that can reduce the errors of traditional automatic methods by using several evaluation results obtained manually. ... evaluation results from a manual method. In the field of machine translation, Yasuda et al. (2003) proposed an automatic method that gives an evaluation result of a translation system as a...
  • 8
  • 359
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Variation of growth in Danish provenance trials with oak (Quercus robur L and Quercus petraea Mattuschka Liebl" pptx

... production parameters are also sen-sitive to thinning strength.ECOTYPES AND CLINAL VARIATIONOF OAK IN THE REMAINING TRIALSSome other traits have been observed in the other ... clinal variationand several ecotypes may exhibit consid-erable variation. Such factors should betaken into consideration in choosing oakprovenances, whether the goals are ... observations.The importance of oak for production ofhigh quality wood and as a stabilizing andesthetic element of forests and landscapeshas in recent years increased interest...
  • 5
  • 252
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ