báo cáo khoa học: "The transplant iron score as a predictor

báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx

... Iron Score. Based on these groupings, a univariate relative risk of death was calculated for each iron parameter using haz- ard regression analysis. Survival time was measured from the date of transplant ... one was classified as a "low" score. For purposes of comparing the Transplant Iron Score to other individual or combinations of iron parameters, ea...

Ngày tải lên : 10/08/2014, 22:20

9
320
0

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

... 912–919. 66 Kuroda J, Kimura S, Strasser A, Andreef A, O’Reilly LA, Ashihara E, Kamitsuji Y, Yokota A, Kawata E, Takeuchi M et al. (2007) Apoptosis-based dual mole- cular targeting by INNO-406, a second-generation Bcr ... 3¢-kinase; PKB, protein kinase B (also known as Akt); PUMA, p53-upregulated modulator of apoptosis; RACK1, receptor for activated C-kinase-1; RAS, rat sarcoma virus...

Ngày tải lên : 16/03/2014, 00:20

13
453
0

Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

... DG H 2 O D -values (conformational stability in absence of denaturant) was then calculated. [ 3 H]-cGMP binding assay To assay the capability of PKG wild-type to bind cGMP at different urea concentrations, ... Genetic Analyzer at the DNA-Analysis Core Facility, University of Vermont (Burlington, VT, USA). Preparation of bacumid DNA, transfection of Sf9 cells and two rounds of Bacu...

Ngày tải lên : 07/03/2014, 09:20

13
440
0

Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

... the bifunctional enzymes chorismate mutase–prephenate dehydratase and chorismate mutase–prephenate dehydratase were deleted. Monofunctional versions of the dehydratase and the dehydrogenase are provided ... overall reaction [50]. A rationally designed variant of L -Ala- D / L -Glu epimerase (a third member of the enolase superfamily, Fig. 8), containing a mutation (D297G) analogou...

Ngày tải lên : 19/02/2014, 12:20

8
635
0

Báo cáo khoa học: "The Back-translation Score: Automatic MT Evaluation at the Sentence Level without Reference Translations" pptx

... 35 43002 Tarragona, Spain reinhard.rapp@urv.cat Abstract Automatic tools for machine translation (MT) evaluation such as BLEU are well established, but have the drawbacks that they do ... 2009. c 2009 ACL and AFNLP The Back-translation Score: Automatic MT Evaluation at the Sentence Level without Reference Translations Reinhard Rapp Universitat Rovira i Virgili Avinguda Catalun...

Ngày tải lên : 31/03/2014, 00:20

4
298
0

Tài liệu Báo cáo khoa học: The cellulosomes from Clostridium cellulolyticum Identiﬁcation of new components and synergies between complexes ppt

... identified as the mannanase Man2 6A [14]. Lastly, protein 13 was identified as an N-terminal dockerin-borne chagasin domain. Chagasin belongs to Fig. 4. Enzymatic activities of the cellulosome fractions ... straw, all fractions showed a substantial level of activity that was never less than half that of the most active fraction, F1. On Avicel, F5 was the most efficient fraction, a...

Ngày tải lên : 18/02/2014, 08:20

11
599
0

Tài liệu Báo cáo khoa học: The lipid ⁄ protein interface as xenobiotic target site Kinetic analysis of tadpole narcosis ppt

... volatile anesthetics. Anesth Analges 95, 578–582. 38 Takasaki M, Tatara T, Suezaki Y, Shirahama K, Kamaya H, Ueda I & Totoki T (1991) Effect of inhala- tion anesthetics on swimming activity of Artermia salina. ... of comparable quality. Overall, statistical quality was determined by the quality of the data sets used. Discussion Animal narcosis Narcosis is assessed by some all-or-n...

Ngày tải lên : 19/02/2014, 18:20

8
382
0

Báo cáo khoa học: The 2-oxoacid dehydrogenase multi-enzyme complex of the archaeon Thermoplasma acidophilum ) recombinant expression, assembly and characterization docx

... CTACGAGA GCTAGCATGTACGATGC AATAATAATAGGTTC E3 reverse: TTTAAAAATG GAATTCAATGAGAT GGT. PCR ampliﬁcation was carried out using Vent polymer- ase, and A- tails were added to the products with Taq poly- merase. Both ... Oligonucleotides were as follows (restriction sequences are underlined): E2 forward: CGC CATATGTACGAATTCAAACTGC CAGACATAGG E2 reverse: CCG CTCGAGTCAGATCTCGTAGAT TATAGCGTTCGG E3...

Ngày tải lên : 16/03/2014, 05:20

10
338
0

Báo cáo khoa học: " The Signal System in Interlingua — A Factor in Mechanical Translation" potx

... Russian balalaika and a resonant Spanish guitar, and so forth make fascinating material for descriptive and analytical studies in some branch of meta- linguistics. But no fundamental research ... view of translation and of mechanical translation in par- ticular is not that the signal system of departure language and target language be complete in any absolute sense of the...

Ngày tải lên : 16/03/2014, 19:20

6
338
0

Báo cáo khoa học: "The Human Language Project: Building a Universal Corpus of the World’s Languages" pptx

... language as the meaning representation, we arrive back at machine translation as the measure of success. In short, we have successfully captured a language if we can translate into and out of ... approximation to language understanding. Here is another way to put it. One measure of adequacy of a language digitization is the abil- ity of a human—already ﬂuent in a refer...

Ngày tải lên : 16/03/2014, 23:20

10
574
0