báo cáo khoa học: "R-CHOP versus R-CVP in the treatment of follicular lymphoma: a meta-analysis and critical appraisal of current literature" ppt

Báo cáo khoa học: Structure–cytotoxicity relationships in bovine seminal ribonuclease: new insights from heat and chemical denaturation studies on variants ppt

Báo cáo khoa học: Structure–cytotoxicity relationships in bovine seminal ribonuclease: new insights from heat and chemical denaturation studies on variants ppt

... is the ellipticity at 222 nm at a given temperature, and Q max and Q min are the maximum and minimum values of ellipticity corresponding to the denaturated state and native state of proteins, respectively. C. ... engendering a lower melting temperature of the R80S variants. Urea denaturation of NCD forms The conformational stability of the NCD forms against...
Ngày tải lên : 22/03/2014, 17:20
  • 12
  • 300
  • 0
Báo cáo khoa học: "Successful enteral nutrition in the treatment of esophagojejunal fistula after total gastrectomy in gastric cancer patients" pps

Báo cáo khoa học: "Successful enteral nutrition in the treatment of esophagojejunal fistula after total gastrectomy in gastric cancer patients" pps

... fluoro- scopy. In Figure 2 you can appreciate the le aking area, the fistula duct, as well as the naso-enteral tube located distally to the l eaking area. It was verified that the tube was in the intestinal ... to the adequate place, in the intestinal lumen,distaltothezoneofescape(Figure4).This emphasizes the importance of experience in the hand- ling of this a...
Ngày tải lên : 09/08/2014, 03:22
  • 4
  • 241
  • 0
Báo cáo khoa học: "Intraoperative radiation therapy in the treatment of early-stage breast cancer utilizing xoft axxent electronic brachytherapy" ppt

Báo cáo khoa học: "Intraoperative radiation therapy in the treatment of early-stage breast cancer utilizing xoft axxent electronic brachytherapy" ppt

... Access Technical innovations Intraoperative radiation therapy in the treatment of early-stage breast cancer utilizing xoft axxent electronic brachytherapy Adam Dickler* 1 , Olga Ivanov 2 and Darius Francescatti 3 Address: ... the volume of treatment and increasing the daily fraction size of the radiation, treat- ment can be accomplished in one week rather than the...
Ngày tải lên : 09/08/2014, 04:21
  • 6
  • 499
  • 0
Báo cáo khoa học: " Science review: Carnitine in the treatment of valproic acid-induced toxicity – what is the evidence" pot

Báo cáo khoa học: " Science review: Carnitine in the treatment of valproic acid-induced toxicity – what is the evidence" pot

... glutamine through the mitochondrial membrane, thereby enhancing glutaminase activity. Ammonia is released as a result of the transformation of glutamine into glutamate [78,79]. Both animal [76] and ... daily). Prolonged L-carnitine supplementation was associated with normalization in plasma ammonia concentrations and marked increase in carnitine concentration in all 15 pat...
Ngày tải lên : 12/08/2014, 22:22
  • 10
  • 476
  • 0
Báo cáo y học: " Pentobarbital versus thiopental in the treatment of refractory intracranial hypertension in patients with traumatic brain injury: a randomized controlled trial" ppsx

Báo cáo y học: " Pentobarbital versus thiopental in the treatment of refractory intracranial hypertension in patients with traumatic brain injury: a randomized controlled trial" ppsx

... criteria [13]. Data are presented as number of cases and as a percentage of the total number of cases each day. Figure 1 AUC of ICP dataAUC of ICP data. Presented are areas under the curve (AUCs) of ... 53:186-194. 7. The Brain Trauma Foundation: The American Association of Neurological Surgeons. The Joint Section on Neurotrauma and Critical Care. Critical...
Ngày tải lên : 13/08/2014, 11:22
  • 10
  • 366
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a GSP-...
Ngày tải lên : 14/02/2014, 14:20
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

... microliters of supernatant was added to 175 lL of distilled water and 25 lL of ATP assay mix [Bioluminescent Somatic Cell Assay Kit (FL-AA); Sigma, St Louis, MO] containing luciferin and luciferase. The ... employed a mixture of 5mm malate and 25 lm palmitoyl-l-carnitine as oxidative substrates. State 2 respiration (resting) was measured after addition of oxidative substra...
Ngày tải lên : 18/02/2014, 16:20
  • 7
  • 582
  • 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... binding the ion and also for the rotational mechanism of the ring. The c ring of I. tartaricus has 11 negative charges that are equally distributed along the horizontal axis of the rotor [8]. A positive ... The C-terminal helices show a clear handedness, and two of the rings face in the opposite direction in the membrane to the other two, forming the...
Ngày tải lên : 18/02/2014, 17:20
  • 9
  • 773
  • 0
Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebrafish pptx

Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebrafish pptx

... transcripts are found in the organizer of gastrula embryos, later in the prechordal plate and axial mesoderm (Fig. 2). By contrast, noggin2 tran- scripts are detected at the end of gastrulation in the axial ... other members of the TGF-b family, binding to and inhibit- ing these signaling molecules from binding to their receptors in the extracellular space, thus...
Ngày tải lên : 19/02/2014, 00:20
  • 8
  • 845
  • 0
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... Osanai K, Takahashi K, Nakamura K, Takahashi M, Ishigaki M, Sakuma T, Toga H, Suzuki T & Voelker DR (2005) Expression and characterization of Rab38, a new member of the Rab small G protein ... bonded into a cylindrical barrel [3,4]. The b-barrel proteins have an unusual primary structure with many strands of alternating hydrophi- lic and hydrophobic residues and a hi...
Ngày tải lên : 19/02/2014, 07:20
  • 9
  • 554
  • 0

Xem thêm

Từ khóa: