Báo cáo y học: " Development and evaluation of a tool for th

Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf

... and read and approved the final manuscript. Additional material Additional file 1 Development and evaluation of a tool for the assessment of footwear characteristics compressed folder. The compressed ... Central Page 1 of 12 (page number not for citation purposes) Journal of Foot and Ankle Research Open Access Research Development and evaluation o...

Ngày tải lên : 10/08/2014, 21:23

12
379
0

Báo cáo y học: "omparative and functional genomics provide insights into the pathogenicity of dermatophytic fungi" pps

... annotated manually and compared to the automated predictions, indicating a specificity of 82% at a sensitivity of 97%. For the annotation and comparative analyses of the gen- omes a web based genome ... the basic meta- bolic machinery for glycolysis, tricarboxylic acid cycle, glyoxylate cycle, pentose phosphate shunt, and synthesis of all 20 standard a mino a...

Ngày tải lên : 09/08/2014, 22:23

16
463
0

Báo cáo y học: "Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis" pps

... already scheduled for coronary angiography for any indication and had no history of a coronary revascularization procedure prior to the scheduled angiography. Forty-four patients had a history ... 260 and economic evaluation, of myocardial perfusion scintigraphy for the diagnosis and management of angina and myocardial infarction. Health Technol Assess. 2004;...

Ngày tải lên : 08/08/2014, 16:23

15
456
0

Báo cáo y học: " Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis after coronary revascularization" doc

... Metcalfe M. Systematic review of the effectiveness and cost-effectiveness, and economic evaluation, of myocardial perfusion scintigraphy for the diagnosis and management of angina and myocardial ... Harris RA, et al. The role of coronary angiography and coronary revascularization before noncardiac vascular surgery. JAMA. 1995; 273: 1919-1925. 8. Scanlon PJ, Faxo...

Ngày tải lên : 08/08/2014, 17:20

12
418
0

Báo cáo y học: "Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia" ppt

... Hematology, University of Perugia, Perugia, Italy). The forward and backward primers were: 5’-CGGGATCCATCGAAGGTCGTGAAGATTCGAT GGACAT-3’, and 5’-CGCGCGACCGAGCGGAA GCTTCTATTTTCTTAAAGAGAC-3’. Underlined ... protein. The purified protein was dialysed against phosphate-buffered saline (PBS) overnight at 4°C and stored at -80°C before analyzed by SDS-PAGE and quantitated by usin...

Ngày tải lên : 08/08/2014, 18:21

6
431
0

Báo cáo khoa học: "Near infrared analysis as a tool for rapid screening of some major wood characteristics in a eucalyptus breeding program" ppsx

... standard error (deviation) for the x values (reference method values); SEC: standard error of calibration; SECV: standard error of cross-validation; SEL: standard error for the laboratory data ... enhancing end-product quality. The ability to assess wood quality is a critical challenge facing the forest industry. In intensively managed forests such as clonal eucalyptus plant...

Ngày tải lên : 08/08/2014, 14:20

12
316
0

Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf

... nonterminal labels of the treebank grammar. For example, our grammar main- tains a fairly large number of semantic classes of singular nouns, and it is natural to stipulate that each of them is label-consistent ... value of a large bracketed training corpus is that it allows the grammar- ian to obtain quickly a very large 3 set of sentences that 2Actually there...

Ngày tải lên : 08/03/2014, 07:20

8
562
0

báo cáo hóa học: " Development and evaluation of a computer-based medical work assessment programme" pdf

... Main and second activities Status CA1 CA MA1, SA MA, SA1 MA, SA MA, SA MA, SA Event +CA2 +SA +MA2 + SA2 +CA -SA -MA Result CA1 stop CA → MA MA1 stop SA1 stop MA stop SA stop MA stop CA2 start SA ... SA start MA2 start SA2 start SA stop MA → CA SA stop CA start SA → CA CA start CA = Central Activity (no second activity). MA = M ain Activity. SA = S econd Activity. Journal of Occupational M...

Ngày tải lên : 20/06/2014, 00:20

5
381
0

Báo cáo hóa học: " Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses" pdf

... CGTCTCAGTGATCCG- GGGG 3', Ts2: 5'CGCCACAAGGGCCATGAACAG 3', Ts3: 5' TAACATCATCATGAGACAGAGC 3' and Ts4: 5'TGTTGTCTTAAACAAGAGAGGTC3'), as reported earlier [6]. Single-step Dengue ... Furthermore, all the serum samples from a panel of 40 healthy individuals analyzed in this study revealed no amplification, thereby establishing the specificity of this...

Ngày tải lên : 20/06/2014, 01:20

5
482
0

báo cáo hóa học:" Development and evaluation of a clinical algorithm to monitor patients on antiretrovirals in resource-limited settings using adherence, clinical and CD4 cell count criteria" ppt

... Taylor, Petra Schaefer, David Thomas, Keith McAdam and all the staff of the Adult Infectious Disease Clinic and the Academic Alliance. The study was funded by the Division of Intramural Research ... not for citation purposes) Table 1: Univariate analysis of variables associated with viral failure in 496 Ugandans on ART at the Infectious Diseases Institute, Kampala, Ug...

Ngày tải lên : 20/06/2014, 08:20

10
533
0