cáo khoa học: " Enhancing implementation of tobacco use prevention and cessation counselling guideline among dental providers: a cluster randomised controlled trial" doc

... Murtomaa1AbstractBackground: Tobacco use adversely affects oral health. Tobacco use prevention and cessation (TUPAC) counselling guidelines recommend that healthcare providers ask about each patient’s ... implementation of tobacco use prevention and cessation counselling guideline among dental providers: a cluster randomised controlled trial. Implementation Science 2011 6:13.Submit your next manuscript ... settings and professionaldisciplines.Additional materialAdditional file 1: Explanatory statement of the study, Tampere.Additional file 2: Explanatory statement of the study, Vaasa.Additional file...

báo cáo khoa học: " Assessing implementation difficulties in tobacco use prevention and cessation counselling among dental providers" potx

... theTampere and Vaasa municipal dental clinics for generously giving their timefor this study. We further thank chief dental officers Eeva Torppa-Saarinen,Anne-Mari Aaltonen, and Jukka Kentala ... measuring all aspects of eachdom ain and select the key point of each. The allocation of certain items to domains was not always clear. Forexample, the item from the domain motivation and goals ... Institute for Health and Welfare; 2009.6. Helakorpi S, Laitalainen E, Uutela A: Health Behaviour and Health among the Finnish Adult Population. The National Institute for Health and Welfare; 2009.7....

Báo cáo khoa học: The occurrence of riboﬂavin kinase and FAD synthetase ensures FAD synthesis in tobacco mitochondria and maintenance of cellular redox status docx

... cloning, recombinantexpression and puriﬁcation of two new monofunctionalFADS enzymes from Arabidopsis thaliana (AtRibF1 and AtRibF2) was achieved by Sandoval et al. [43], asthis article was being ... 5.5) and treated with Caylase (Cayla, Tou-lose, France) and pectinase (Sigma-Aldrich), as described in[13]. Intact puriﬁed mitochondria and plastids wereobtained by protoplast fractionation and ... [32]) or anantiserum against the chaperonin (i.e. a- Cnp, a kind giftfrom C. Indiveri, Universita`della Calabria, Calabria, Italy). a- FAD- and a- Cnp-immunoreactive materials were visual-ized...

Báo cáo khoa học: Enhancing thermostability of maltogenic amylase from Bacillus thermoalkalophilus ET2 by DNA shufﬂing pdf

... is a reductionin the number of glutamines and asparagines, as thesetwo amino acids are easily deamidated at elevatedtemperatures [34–36]. Examination of amino acidcompositions of the total ... Zhang N, Xiao L, Madison V & Zaks A (2004) Improved activity and thermostability of Candidaantarctica lipase B by DNA family shufﬂing. ProteinEng Des Sel 17, 133–140.24 Oslancova A & ... 663–674.48 Numata K, Hayashi-Iwasaki Y, Kawaguchi J, SakuraiM, Moriyama H, Tanaka N & Oshima T (2001) Ther-mostabilization of a chimeric enzyme by residue substi-tutions: four amino acid residues...

Báo cáo khoa học: "Enhancing Performance of Lexicalised Grammars" pdf

... models, with and without POS tags as features, wereused.While POS taggers such as TreeTagger are com-mon, and there some supertaggers are available, no-tably that of Clark and Curran (2007) ... onTheoretical and Methodological Issues in MachineTranslation, Baltimore, USA.Stephan Oepen. 2001. [incr tsdb()] – competence and performance laboratory. User manual, ComputationalLinguistics, Saarland ... Carroll, and Rob Malouf. 1999. A bag of useful techniques for ef-ﬁcient and robust parsing. In Proceedings of the 37thAnnual Meeting of the ACL, pages 473–480, Mary-land, USA.Stefan M¨uller and...

Báo cáo khoa học: "An Implementation of Combined Partial Parser and Morphosyntactic Disambiguator" pptx

... The Implementation 3.1 ObjectivesThe goal of the implementation was a combined par-tial parser and tagger that would be reasonably fast,but at the same time easy to modify and maintain. Atthe ... forms and a list of interpre-tations; for group — number of heads of the group and lists of interpretations of syntactic and semantichead.Every interpretation consists of a base form and a morphosyntactic ... input and disambiguating itwith the same rules that are used for parsing. Thispaper presents a formalism and a working prototype of a tool implementing simultaneous rule-based dis-ambiguation and...

báo cáo khoa học: " The implementation of a translational study involving a primary care based behavioral program to improve blood pressure control: The HTN-IMPROVE study protocol " pot

... organizational model of implementation suitable for complex innovations and adapted to the context of clinical practice. An additionalproduct of this phase of the study is an evaluation of approaches ... threephases: data coding, within-case analysis, and between-case analysis. In the first phase, we use qualitative dataanalysis software (ATLAS.ti 5.2) to code the study data.The conceptual model ... to gather dataon organizational readiness for change, implementation policies and practices, implementation climate, user-val-ues fit, management support, and situational factors thatmight positively...

Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in ﬁbrinolysis and plasmin-induced cell detachment and apoptosis docx

... Montes R, Paramo JA, Angles-Cano E & Rocha E(1996) Development and clinical application of a newELISA assay to determine plasmin-alpha2-antiplasmincomplexes in plasma. Br J Haematol 92, ... cells; lane 5, Glu-Pg- and mAb A1 0.2-treated cells; lane 6, Glu-Pg- and mAb 34D3-trea-ted cells. Bands in lanes 1 and 2 correspond to forms I and II of plasmin(ogen). High molecular weight bands ... bothK1 and K4 in ﬁrmly anchoring plasmin to ﬁbrin and cell surfaces. Because the expanded Lys-form of plasminogen may be an intermediary in plasmin for-mation [51,52], we have also evaluated its...

Tài liệu Báo cáo khoa học: Transactivation properties of c-Myb are critically dependent on two SUMO-1 acceptor sites that are conjugated in a PIASy enhanced manner pptx

... the activity of the factor.Even a conservative mutation (KﬁR) keeping the chargeunchanged, causes a large enhancement of the activity of c-Mybbothintransfectionassaysandwhenactivationofanendogenous ... dividedwithonethirdusedforpreparationofthetotalfraction(T)andtheremaining two-thirds used to make the soluble and nuclear matrixfraction. Total protein concentration of the soluble fraction was usedto normalize ... both a 5-bromo-4-chlorindol-3-yl b-D-galactosideoverlay and a liquid b-galactosidase assay (Fig. 3). Similaranalysis of several subdomains of c-Myb revealed strongestsubdomain interaction...

Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx

... Germany). T he sense and antisenseprimers for b1 were GTCAGCTAGCTAACGAGGTGGAGTCCGGTTAC and GTCACTCGAGCTAAAGGCCCGTCTGGTGAATCAAG, respectively, and for b2GTCAGCTAGCCCGTCCCTGTGACTGTGATG and ... generatedrabbit antisera against recombinant mouse b1IV and b2IV.These antisera had high titers (half-maximal binding) atdilutions of 1 : 4000 (anti- b1) and 1 : 20 000 (anti-b2) inELISA and ... ¯exible, and we suggest that partialformation of C3±C4 and C4±C5 bridges occur as well.Immunochemical assays for domains b1IV and b2IV and their application to the analysis of tissuesMany previous...

Xem thêm