cáo khoa học: " Towards an organisation-wide process-oriented organisation of care: A literature review" pptx

... costs and organisation was not as dramatic as initially anticipated (initialtargets were ambitious); The overall efficiency was nottransformed (as assessed through a quantitative evaluation of its ... financial performance, operational effi-ciency, and patient satisfaction using hospital data andpatient surveys [46].Approaches used to move towards a process-oriented organisation Coordination ... of transformationwas a clinician, who drew on her professional status andfamiliarity with clinical practice; Political and financial support of the city; Training of nurses, clinicians and middle...

Báo cáo khoa học: "TOWARDS AN INTEGRATED ENVIRONMENT FOR SPANISH DOCUMENT VERIFICATION AND COMPOSITION" pptx

... example, the word circular can be an adjective (marked as j, meaning 'circular'), a feminine noun (marked as nf, meaning 'note'), and a verb (marked as v, meaning 'move', ... Sopefia, C. Villar IBM Madrid Scientific Center Paseo de la Castellana, 4 28046 Madrid ABSTRACT Languages other than English have received little attention as far as the application of natural ... la Lengua Espafiola, Ed. Gustavo Gill, Barcelona, 1982. [8] I)iccionario Anaya de la Lengua, Ed. Anaya, Ma- drid 198{}. [9l Seco, M.: Dieeionarin de dudas y dificultades de la lengua espafiola,...

Báo cáo khoa học: "Mineral nutrient concentrations in sapwood and heartwood: a literature review" ppt

... statistically analysed with SYSTAT. Cross-spe-cies means, standard deviations, minimum and maximum values forsapwood and heartwood concentrations were calculated separatelyfor Gymnosperms and ... ratios of different elements were as-sessed by means of Spearman rank correlation coefficient. An allometric approach was applied to analyse correlation patterns be-tween heartwood and sapwood ... 1068–1074.[68] Takashima Y., Koike M., Imaizumi Y., Harada T., Distribution andextraction behavior of elements in annual rings of Cryptomeria japonica andAbies firma, Bunseki Kagaku 43 (1994)...

Báo cáo khoa học: "Towards an Iterative Reinforcement Approach for Simultaneous Document Summarization and Keyword Extraction" doc

... text semantic similarity. In Proceedings of AAAI-06.R. Mihalcea and P. Tarau. 2004. TextRank: Bringing order into texts. In Proceedings of EMNLP2004.R. Mihalcea and P.Tarau. 2005. A language ... recently, graph-based ranking methods, in-cluding TextRank ((Mihalcea and Tarau, 2004, 2005) and LexPageRank (ErKan and Radev, 2004) have been proposed for document summarization. Similar to Kleinberg’s ... using n-gram co-occurrence statistics. In Proceedings of HLT-NAACL2003, Edmonton, Canada, May. R. Mihalcea, C. Corley, and C. Strapparava. 2006. Corpus-based and knowledge-based measures of text...

Báo cáo khoa học: "Towards an Optimal Lexicalization in a Natural-Sounding Portable Natural Language Generator for Dialog Systems" pdf

... set of output candidates is as follows: • You can buy a tent at Camping World. • You can purchase a tent at Camping World. • You can get a tent at Camping World. • You can acquire a tent at ... most natural-sounding candi-date (or at least one of the most natural-sounding candidates, if more than one candidate fits that cri-terion). There are a number of directions we can take for ... Proceedings of the ACL Student Research Workshop, pages 61–66,Ann Arbor, Michigan, June 2005.c2005 Association for Computational Linguistics Towards an Optimal Lexicalization in a Natural-Sounding...

Báo cáo khoa học: "Towards an Adaptive Communication Aid with Text Input from Ambiguous Keyboards" pptx

... key-boards: Application to Catalan. Procesamiento delLenguaje Natural, 27:65-70.Karin Harbusch, Saga Hasan, Hajo Hoffmann, MichaelKiihn, and Bernhard Schiller. 2003. Domain—specific disambiguation ... suggestionsReferencesJohn L. Arnott and Muhammad Y. Javed. 1992. Prob-abilistic character disambiguation for reduced key-boards using small text samples. AAC Augmentativeand Alternative Communication, 8(1): ... .R. Harald Baayen, Richard Piepenbrock, and Leon Gu-likers. 1995. The CELEX lexical database (re-lease 2), [CD-ROM]. Linguistic Data Consortium,Philadelphia, PA.Marco Baroni, Johannes Matiasek,...

Báo cáo khoa học: "TOWARDS AN AUTOMATIC IDENTIFICATION 0F TOPIC AND FOCUS" pdf

... (11) (a) John made a canoe out of a LOG. (b) John made a CANOE out of a log. (12) (a) John made a log into a CANOE. (b) It was a LOG John made into a canoe. Thus, in the (b) sentences a few ap- ... (TFA) is understood as one of the hierarchies of the level of meaning, whose other two hierarchies are that of dependency syn- tax (close to case grammar) and that of coordination (and apposition) ... to substantiate the claim that the output of an automatic analysis should represent among other things also the hierarchy of toplc-focus articulation, and (ii) to present a general procedure...

Báo cáo khoa học: "GRAMMATICAL AN ALYSIS BY COMPUTER OF THE LANCASTER OSLO/BERGEN (LOB) CORPUS OF BRITISH ENGLISH TEXTS." potx

... Computer Research on the English Language Bowland College, University of Lancaster Bailrigg, Lancaster, England LA1 aYT. ABSTRACT Research has been under way at the Unit for Computer Research on ... ~hglish Language at the University of Lancaster, England, to develop a suite of computer programs which provide a detailed grammatical analysis of the LOB corpus, a collection of about 1 million ... much alive toda~v. Storage, retrieval and processing of natural language text is a more efficient and less laborious task with modern computer hardware than it was with hand-written card files...

Báo cáo khoa học: Towards understanding the functional role of the glycosyltransferases involved in the biosynthesis of Moraxella catarrhalis lipooligosaccharide ppt

... RDORF3:3434 GCGTATTAAGAACTTACAAGG Within lgt1 R2951:DORF 3A AACTCAACAAGATAGTCAAAC Within lgt22951F2951:UORF 3A ATGATAAAGTACTCAATGGTG Within lgt4 RPrimers used to amplify and ⁄ or sequence ... TTTCTAGATTTATACCATGGTG Within lgt5 RDORF4:4132 AAAAGAAGACAAACAAGCAGC Within lgt5 RDORF4:5047 TTATCGGTACATATTGATTGG Downstream of lgt5 RMoraxella catarrhalis LOS biosynthesis I. R. Peak et al.2026 ... transfer of bacteria to BHI ⁄ kanamycinplates and overnight incubation at 37 °C. Sterile NaCl ⁄ Pi(30 lL) was added instead of the DNA as control in eachtransformation.Standard recombinant...

Báo cáo khoa học: "Estrogen receptor independent neurotoxic mechanism of bisphenol A, an environmental estrogen" potx

... h 2" alt ="" ...

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ